\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327579645:

Variant ID: vg0327579645 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27579645
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TGCATGAATGATGTGGCATATCCACGTGGTATTTTAAGTGAGTCAAGGACTATATTAAGCCGCATGATAATCCTTTAGAACTTATTTGGACATTATAAAA[T/C]
ATTAAGGACTAATTCGATCCCTGAGCAAAAGTTGAAGGAGTGAACTGACTATTCACCCTATAATTTTATAAAAGGAGGGAGTAGTAAGAAAAAGGGCCTT

Reverse complement sequence

AAGGCCCTTTTTCTTACTACTCCCTCCTTTTATAAAATTATAGGGTGAATAGTCAGTTCACTCCTTCAACTTTTGCTCAGGGATCGAATTAGTCCTTAAT[A/G]
TTTTATAATGTCCAAATAAGTTCTAAAGGATTATCATGCGGCTTAATATAGTCCTTGACTCACTTAAAATACCACGTGGATATGCCACATCATTCATGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 19.30% 0.85% 5.92% NA
All Indica  2759 67.80% 20.80% 1.34% 10.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 1.90% 97.80% 0.37% 0.00% NA
Indica I  595 54.30% 1.50% 4.37% 39.83% NA
Indica II  465 43.90% 54.20% 1.08% 0.86% NA
Indica III  913 89.20% 10.30% 0.11% 0.44% NA
Indica Intermediate  786 67.40% 28.00% 0.64% 3.94% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 67.80% 25.60% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327579645 T -> C LOC_Os03g48430.1 downstream_gene_variant ; 1264.0bp to feature; MODIFIER silent_mutation Average:31.383; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0327579645 T -> C LOC_Os03g48440.1 downstream_gene_variant ; 4240.0bp to feature; MODIFIER silent_mutation Average:31.383; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0327579645 T -> C LOC_Os03g48410-LOC_Os03g48430 intergenic_region ; MODIFIER silent_mutation Average:31.383; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0327579645 T -> DEL N N silent_mutation Average:31.383; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327579645 1.40E-10 3.73E-20 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 8.75E-09 9.39E-15 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 2.00E-12 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 1.61E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 5.56E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 2.29E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 9.36E-20 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 3.09E-10 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 1.15E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 1.10E-11 4.12E-27 mr1193_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 5.91E-10 1.86E-12 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 3.27E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 7.64E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 9.31E-18 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327579645 NA 2.06E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251