\
| Variant ID: vg0327579645 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27579645 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 100. )
TGCATGAATGATGTGGCATATCCACGTGGTATTTTAAGTGAGTCAAGGACTATATTAAGCCGCATGATAATCCTTTAGAACTTATTTGGACATTATAAAA[T/C]
ATTAAGGACTAATTCGATCCCTGAGCAAAAGTTGAAGGAGTGAACTGACTATTCACCCTATAATTTTATAAAAGGAGGGAGTAGTAAGAAAAAGGGCCTT
AAGGCCCTTTTTCTTACTACTCCCTCCTTTTATAAAATTATAGGGTGAATAGTCAGTTCACTCCTTCAACTTTTGCTCAGGGATCGAATTAGTCCTTAAT[A/G]
TTTTATAATGTCCAAATAAGTTCTAAAGGATTATCATGCGGCTTAATATAGTCCTTGACTCACTTAAAATACCACGTGGATATGCCACATCATTCATGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.00% | 19.30% | 0.85% | 5.92% | NA |
| All Indica | 2759 | 67.80% | 20.80% | 1.34% | 10.00% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.90% | 97.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 54.30% | 1.50% | 4.37% | 39.83% | NA |
| Indica II | 465 | 43.90% | 54.20% | 1.08% | 0.86% | NA |
| Indica III | 913 | 89.20% | 10.30% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 67.40% | 28.00% | 0.64% | 3.94% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 61.50% | 38.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 25.60% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327579645 | T -> C | LOC_Os03g48430.1 | downstream_gene_variant ; 1264.0bp to feature; MODIFIER | silent_mutation | Average:31.383; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0327579645 | T -> C | LOC_Os03g48440.1 | downstream_gene_variant ; 4240.0bp to feature; MODIFIER | silent_mutation | Average:31.383; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0327579645 | T -> C | LOC_Os03g48410-LOC_Os03g48430 | intergenic_region ; MODIFIER | silent_mutation | Average:31.383; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0327579645 | T -> DEL | N | N | silent_mutation | Average:31.383; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327579645 | 1.40E-10 | 3.73E-20 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | 8.75E-09 | 9.39E-15 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 2.00E-12 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 1.61E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 5.56E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 2.29E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 9.36E-20 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 3.09E-10 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 1.15E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | 1.10E-11 | 4.12E-27 | mr1193_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | 5.91E-10 | 1.86E-12 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 3.27E-10 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 7.64E-06 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 9.31E-18 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327579645 | NA | 2.06E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |