\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327557116:

Variant ID: vg0327557116 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27557116
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTAATGCTCTGTAGGACAGAGATGGTTAATGTTACCCATTCTCTCCATTTTTTTTCCCATCAACGAATGCTTATTATGAGAATAAGCATGTAACTGGA[C/T]
TGCCAATGGACTTCCTGCTGGATGTAGCAAGGCTGTGATTCTGTTTAGACTTAGTTCTTATCCCCTAATACAATGACGATATATTGTTCTTTCTCAATTT

Reverse complement sequence

AAATTGAGAAAGAACAATATATCGTCATTGTATTAGGGGATAAGAACTAAGTCTAAACAGAATCACAGCCTTGCTACATCCAGCAGGAAGTCCATTGGCA[G/A]
TCCAGTTACATGCTTATTCTCATAATAAGCATTCGTTGATGGGAAAAAAAATGGAGAGAATGGGTAACATTAACCATCTCTGTCCTACAGAGCATTACTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.60% 18.20% 0.06% 0.19% NA
All Indica  2759 69.20% 30.40% 0.07% 0.33% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 50.90% 48.70% 0.34% 0.00% NA
Indica II  465 49.50% 49.20% 0.00% 1.29% NA
Indica III  913 91.10% 8.90% 0.00% 0.00% NA
Indica Intermediate  786 69.10% 30.50% 0.00% 0.38% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327557116 C -> T LOC_Os03g48400.1 upstream_gene_variant ; 51.0bp to feature; MODIFIER silent_mutation Average:31.719; most accessible tissue: Callus, score: 59.151 N N N N
vg0327557116 C -> T LOC_Os03g48390.1 downstream_gene_variant ; 2880.0bp to feature; MODIFIER silent_mutation Average:31.719; most accessible tissue: Callus, score: 59.151 N N N N
vg0327557116 C -> T LOC_Os03g48400-LOC_Os03g48410 intergenic_region ; MODIFIER silent_mutation Average:31.719; most accessible tissue: Callus, score: 59.151 N N N N
vg0327557116 C -> DEL N N silent_mutation Average:31.719; most accessible tissue: Callus, score: 59.151 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327557116 2.84E-08 2.97E-10 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116 5.86E-07 1.49E-10 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116 NA 2.91E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116 NA 4.37E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116 NA 2.06E-15 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116 NA 3.77E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116 4.43E-09 7.75E-12 mr1193_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327557116 1.46E-08 3.10E-13 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251