\
| Variant ID: vg0327557116 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27557116 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 232. )
AAGTAATGCTCTGTAGGACAGAGATGGTTAATGTTACCCATTCTCTCCATTTTTTTTCCCATCAACGAATGCTTATTATGAGAATAAGCATGTAACTGGA[C/T]
TGCCAATGGACTTCCTGCTGGATGTAGCAAGGCTGTGATTCTGTTTAGACTTAGTTCTTATCCCCTAATACAATGACGATATATTGTTCTTTCTCAATTT
AAATTGAGAAAGAACAATATATCGTCATTGTATTAGGGGATAAGAACTAAGTCTAAACAGAATCACAGCCTTGCTACATCCAGCAGGAAGTCCATTGGCA[G/A]
TCCAGTTACATGCTTATTCTCATAATAAGCATTCGTTGATGGGAAAAAAAATGGAGAGAATGGGTAACATTAACCATCTCTGTCCTACAGAGCATTACTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.60% | 18.20% | 0.06% | 0.19% | NA |
| All Indica | 2759 | 69.20% | 30.40% | 0.07% | 0.33% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 50.90% | 48.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 49.50% | 49.20% | 0.00% | 1.29% | NA |
| Indica III | 913 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 69.10% | 30.50% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327557116 | C -> T | LOC_Os03g48400.1 | upstream_gene_variant ; 51.0bp to feature; MODIFIER | silent_mutation | Average:31.719; most accessible tissue: Callus, score: 59.151 | N | N | N | N |
| vg0327557116 | C -> T | LOC_Os03g48390.1 | downstream_gene_variant ; 2880.0bp to feature; MODIFIER | silent_mutation | Average:31.719; most accessible tissue: Callus, score: 59.151 | N | N | N | N |
| vg0327557116 | C -> T | LOC_Os03g48400-LOC_Os03g48410 | intergenic_region ; MODIFIER | silent_mutation | Average:31.719; most accessible tissue: Callus, score: 59.151 | N | N | N | N |
| vg0327557116 | C -> DEL | N | N | silent_mutation | Average:31.719; most accessible tissue: Callus, score: 59.151 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327557116 | 2.84E-08 | 2.97E-10 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327557116 | 5.86E-07 | 1.49E-10 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327557116 | NA | 2.91E-06 | mr1225 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327557116 | NA | 4.37E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327557116 | NA | 2.06E-15 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327557116 | NA | 3.77E-07 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327557116 | 4.43E-09 | 7.75E-12 | mr1193_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327557116 | 1.46E-08 | 3.10E-13 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |