\
| Variant ID: vg0327526494 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27526494 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, T: 0.07, others allele: 0.00, population size: 222. )
CGATTTCTTTGTGGGCAGACCTGTGGCAGCAGTTCATCGCCAATTTCCAAGGAACTTACAAGCGCCACGCGATTGAAGATGACCTACATGCGTTGACACA[T/G]
AACTCGGGTGAATCCCTACGGGAATTTGTTCGGCGCTTTAACGAGTGCAGGAATACAATCCCTGAGATCACCGACGCTTCTGTAATTCGCGCCTTTAAGT
ACTTAAAGGCGCGAATTACAGAAGCGTCGGTGATCTCAGGGATTGTATTCCTGCACTCGTTAAAGCGCCGAACAAATTCCCGTAGGGATTCACCCGAGTT[A/C]
TGTGTCAACGCATGTAGGTCATCTTCAATCGCGTGGCGCTTGTAAGTTCCTTGGAAATTGGCGATGAACTGCTGCCACAGGTCTGCCCACAAAGAAATCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 25.70% | 3.72% | 2.26% | NA |
| All Indica | 2759 | 67.70% | 22.20% | 6.23% | 3.84% | NA |
| All Japonica | 1512 | 83.30% | 16.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 1.90% | 98.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 53.40% | 26.10% | 7.39% | 13.11% | NA |
| Indica II | 465 | 50.30% | 37.40% | 9.89% | 2.37% | NA |
| Indica III | 913 | 87.30% | 9.40% | 2.96% | 0.33% | NA |
| Indica Intermediate | 786 | 66.00% | 25.20% | 7.00% | 1.78% | NA |
| Temperate Japonica | 767 | 70.80% | 29.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 7.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 32.20% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327526494 | T -> DEL | LOC_Os03g48330.1 | N | frameshift_variant | Average:44.192; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0327526494 | T -> G | LOC_Os03g48330.1 | missense_variant ; p.His624Gln; MODERATE | stop_gained | Average:44.192; most accessible tissue: Minghui63 young leaf, score: 61.007 | N | N | N | N |
| vg0327526494 | T -> G | LOC_Os03g48330.1 | missense_variant ; p.His624Gln; MODERATE | nonsynonymous_codon ; H624Q | Average:44.192; most accessible tissue: Minghui63 young leaf, score: 61.007 | benign |
-0.592 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327526494 | NA | 1.01E-06 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 1.57E-08 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | 2.02E-07 | NA | mr1309 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 2.38E-06 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 3.72E-08 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 4.62E-08 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 8.36E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 1.33E-07 | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 1.01E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 8.18E-07 | mr1438 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 8.19E-06 | mr1444 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 4.70E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 1.11E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 3.74E-13 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 7.41E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 2.56E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 1.28E-14 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | 2.90E-06 | NA | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 2.03E-11 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 6.41E-09 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327526494 | NA | 1.04E-09 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |