\
| Variant ID: vg0327524627 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 27524627 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 340. )
TGTGGTTTTCCATCATATAATCCCATATCAACTGGATTAGGGCTATTACCTATCAAGGGGCCTGAACCAGTATAATCCTCATCTTTTGTTTGCTCGATGT[C/T]
GTATTACGTAGATCCTTGTACCAACGTACCCCAATACCCTCTATATCCGGTCTACGGGTATCACCCGTCGACAGTGGCGCGCCAGGTAGGGGGACTTGGT
ACCAAGTCCCCCTACCTGGCGCGCCACTGTCGACGGGTGATACCCGTAGACCGGATATAGAGGGTATTGGGGTACGTTGGTACAAGGATCTACGTAATAC[G/A]
ACATCGAGCAAACAAAAGATGAGGATTATACTGGTTCAGGCCCCTTGATAGGTAATAGCCCTAATCCAGTTGATATGGGATTATATGATGGAAAACCACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 5.70% | 1.80% | 1.93% | NA |
| All Indica | 2759 | 84.30% | 9.40% | 3.01% | 3.26% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 53.80% | 24.70% | 11.40% | 10.11% | NA |
| Indica III | 913 | 92.70% | 5.60% | 0.77% | 0.99% | NA |
| Indica Intermediate | 786 | 81.30% | 11.60% | 2.80% | 4.33% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0327524627 | C -> T | LOC_Os03g48330.1 | missense_variant ; p.Ser2Leu; MODERATE | nonsynonymous_codon ; S2L | Average:54.231; most accessible tissue: Minghui63 flag leaf, score: 78.472 | benign |
1.097 |
DELETERIOUS | 0.00 |
| vg0327524627 | C -> DEL | LOC_Os03g48330.1 | N | frameshift_variant | Average:54.231; most accessible tissue: Minghui63 flag leaf, score: 78.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0327524627 | 1.96E-07 | 2.27E-12 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327524627 | 1.42E-06 | 8.63E-12 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327524627 | NA | 4.20E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327524627 | 1.09E-06 | NA | mr1193_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327524627 | 4.58E-06 | 1.44E-08 | mr1193_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327524627 | NA | 2.68E-06 | mr1448_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327524627 | 8.28E-07 | NA | mr1521_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327524627 | 2.44E-06 | 1.89E-06 | mr1521_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0327524627 | NA | 9.04E-06 | mr1659_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |