\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327478719:

Variant ID: vg0327478719 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27478719
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TATATAAGGGTAGAATGGTAATTTCATTCATACCGCTGTATGCGAGGATGACTTGGCATGCTCACGTGGTATTTTTTGTGGGTTCAAGTATTATATTAAC[C/T]
CAAATGATTAATTTGGAGGACTTGTTTAGACGATTTGAAACATTAAGAACTAAATTGAGCCAAAGCGAAATTTTAGGGACGTATTGGCTATTCATCCAAT

Reverse complement sequence

ATTGGATGAATAGCCAATACGTCCCTAAAATTTCGCTTTGGCTCAATTTAGTTCTTAATGTTTCAAATCGTCTAAACAAGTCCTCCAAATTAATCATTTG[G/A]
GTTAATATAATACTTGAACCCACAAAAAATACCACGTGAGCATGCCAAGTCATCCTCGCATACAGCGGTATGAATGAAATTACCATTCTACCCTTATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 43.90% 0.32% 0.00% NA
All Indica  2759 25.60% 73.90% 0.51% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 2.70% 97.10% 0.17% 0.00% NA
Indica II  465 58.10% 41.30% 0.65% 0.00% NA
Indica III  913 20.40% 79.60% 0.00% 0.00% NA
Indica Intermediate  786 29.90% 68.80% 1.27% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327478719 C -> T LOC_Os03g48280.1 downstream_gene_variant ; 4295.0bp to feature; MODIFIER silent_mutation Average:79.727; most accessible tissue: Minghui63 panicle, score: 92.8 N N N N
vg0327478719 C -> T LOC_Os03g48280-LOC_Os03g48300 intergenic_region ; MODIFIER silent_mutation Average:79.727; most accessible tissue: Minghui63 panicle, score: 92.8 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0327478719 C T -0.03 0.01 0.0 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327478719 NA 8.43E-09 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 1.23E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 1.16E-24 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 1.30E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 6.18E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 8.06E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 2.97E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 5.15E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 1.33E-11 NA mr1193_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 1.51E-10 1.03E-11 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 1.81E-14 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 1.04E-07 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 1.60E-37 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327478719 NA 7.60E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251