Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327475017:

Variant ID: vg0327475017 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 27475017
Reference Allele: G	Alternative Allele: C,GA,A
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAATTAAAAACACTTGCTGCTGGAAGATTAAAAAGTAATCAGGAAAAAACGCAAAAAAAAAAAGGAAAGCGAAAAAAAATCACGGAAAAAAAGAAAGC[G/C,GA,A]
AAAAAAAAGGAAAACGGCGGTGGTTACCGAAGAAAAAATTGCGCGCGCGTGCCGCGTGGGCCGGGAGTGCACGCTACCGGCGCGCGCGAGAATTAGGATT

Reverse complement sequence

AATCCTAATTCTCGCGCGCGCCGGTAGCGTGCACTCCCGGCCCACGCGGCACGCGCGCGCAATTTTTTCTTCGGTAACCACCGCCGTTTTCCTTTTTTTT[C/G,TC,T]
GCTTTCTTTTTTTCCGTGATTTTTTTTCGCTTTCCTTTTTTTTTTTGCGTTTTTTCCTGATTACTTTTTAATCTTCCAGCAGCAAGTGTTTTTAATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	37.30%	0.40%	8.27%	GA: 10.07%; A: 0.02%
All Indica	2759	16.20%	62.60%	0.62%	3.81%	GA: 16.71%
All Japonica	1512	98.60%	0.60%	0.00%	0.40%	GA: 0.33%; A: 0.07%
Aus	269	3.30%	1.50%	0.00%	95.17%	NA
Indica I	595	50.30%	48.90%	0.34%	0.00%	GA: 0.50%
Indica II	465	2.20%	40.90%	0.65%	7.10%	GA: 49.25%
Indica III	913	3.90%	84.90%	0.55%	2.96%	GA: 7.67%
Indica Intermediate	786	13.10%	60.10%	0.89%	5.73%	GA: 20.23%
Temperate Japonica	767	99.30%	0.30%	0.00%	0.00%	GA: 0.26%; A: 0.13%
Tropical Japonica	504	97.80%	0.80%	0.00%	0.99%	GA: 0.40%
Japonica Intermediate	241	97.90%	1.20%	0.00%	0.41%	GA: 0.41%
VI/Aromatic	96	85.40%	1.00%	0.00%	13.54%	NA
Intermediate	90	50.00%	24.40%	2.22%	12.22%	GA: 11.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0327475017	G -> C	LOC_Os03g48270.1	downstream_gene_variant ; 2258.0bp to feature; MODIFIER	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N
vg0327475017	G -> C	LOC_Os03g48280.1	downstream_gene_variant ; 593.0bp to feature; MODIFIER	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N
vg0327475017	G -> C	LOC_Os03g48280-LOC_Os03g48300	intergenic_region ; MODIFIER	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N
vg0327475017	G -> A	LOC_Os03g48270.1	downstream_gene_variant ; 2258.0bp to feature; MODIFIER	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N
vg0327475017	G -> A	LOC_Os03g48280.1	downstream_gene_variant ; 593.0bp to feature; MODIFIER	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N
vg0327475017	G -> A	LOC_Os03g48280-LOC_Os03g48300	intergenic_region ; MODIFIER	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N
vg0327475017	G -> DEL	N	N	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N
vg0327475017	G -> GA	LOC_Os03g48270.1	downstream_gene_variant ; 2259.0bp to feature; MODIFIER	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N
vg0327475017	G -> GA	LOC_Os03g48280.1	downstream_gene_variant ; 594.0bp to feature; MODIFIER	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N
vg0327475017	G -> GA	LOC_Os03g48280-LOC_Os03g48300	intergenic_region ; MODIFIER	silent_mutation	Average:56.027; most accessible tissue: Callus, score: 89.16	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0327475017	G	A	0.03	0.02	0.01	0.02	0.03	0.03
vg0327475017	G	C	0.02	0.01	0.01	0.01	0.04	0.05
vg0327475017	G	GA	-0.1	-0.02	0.0	-0.11	-0.04	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0327475017	NA	6.00E-08	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	9.24E-16	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	1.68E-06	NA	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	9.70E-08	3.09E-12	mr1193	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	5.77E-07	mr1225	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	1.66E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	4.14E-06	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	8.67E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	1.11E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	8.81E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	1.44E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	1.34E-08	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	9.99E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	1.19E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	1.36E-08	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	1.36E-08	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	2.89E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	3.82E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	3.54E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	NA	3.02E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	4.41E-07	NA	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327475017	7.45E-08	9.77E-12	mr1193_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251