\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327392349:

Variant ID: vg0327392349 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 27392349
Reference Allele: CAlternative Allele: CATATCCTCTGGGTTAGTAACCT
Primary Allele: CSecondary Allele: CATATCCTCTGGGTTAGTAA CCT

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTAAACTTTGGAGCCAATTTGCATGGCGCCGACCCCCATCATCCGGTCTACACACTCCATTCAAGTCTTAGGCTGTGTTCGTTACTGGGTTAGTAACC[C/CATATCCTCTGGGTTAGTAACCT]
ATCTCCTCTGTACGGAAAACAGACTAGTTCTTTGGCGCGTGATTAATTAAGTATTACTATTTTTTTAAAAATAGATTAATTTGATTTTTTAAGCAATCTT

Reverse complement sequence

AAGATTGCTTAAAAAATCAAATTAATCTATTTTTAAAAAAATAGTAATACTTAATTAATCACGCGCCAAAGAACTAGTCTGTTTTCCGTACAGAGGAGAT[G/AGGTTACTAACCCAGAGGATATG]
GGTTACTAACCCAGTAACGAACACAGCCTAAGACTTGAATGGAGTGTGTAGACCGGATGATGGGGGTCGGCGCCATGCAAATTGGCTCCAAAGTTTAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CATATCCTCTGGGTTAGTAA CCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 12.00% 13.03% 35.61% NA
All Indica  2759 7.80% 20.20% 20.08% 51.94% NA
All Japonica  1512 98.90% 0.20% 0.40% 0.53% NA
Aus  269 9.30% 0.40% 14.50% 75.84% NA
Indica I  595 9.10% 32.90% 21.34% 36.64% NA
Indica II  465 9.20% 17.20% 23.01% 50.54% NA
Indica III  913 4.50% 11.80% 17.31% 66.37% NA
Indica Intermediate  786 9.70% 22.10% 20.61% 47.58% NA
Temperate Japonica  767 99.50% 0.30% 0.13% 0.13% NA
Tropical Japonica  504 98.40% 0.20% 0.60% 0.79% NA
Japonica Intermediate  241 97.90% 0.00% 0.83% 1.24% NA
VI/Aromatic  96 82.30% 1.00% 4.17% 12.50% NA
Intermediate  90 51.10% 5.60% 14.44% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327392349 C -> CATATCCTCTGGGTTAGTAACCT LOC_Os03g48150.1 downstream_gene_variant ; 2690.0bp to feature; MODIFIER silent_mutation Average:58.931; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0327392349 C -> CATATCCTCTGGGTTAGTAACCT LOC_Os03g48140-LOC_Os03g48150 intergenic_region ; MODIFIER silent_mutation Average:58.931; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0327392349 C -> DEL N N silent_mutation Average:58.931; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327392349 NA 7.26E-34 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 2.26E-52 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 3.86E-49 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 8.85E-35 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 7.84E-16 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 5.35E-30 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 3.09E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 1.54E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 1.08E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 7.06E-43 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 2.28E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 6.67E-21 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 2.58E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 1.48E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 1.55E-13 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 1.49E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 2.66E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 4.16E-16 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 3.22E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 8.25E-54 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 5.79E-06 mr1134_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 6.83E-34 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 4.91E-23 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 3.50E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 2.17E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 8.48E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 2.43E-44 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 1.76E-06 mr1672_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 1.93E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 5.77E-08 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 2.34E-07 NA mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 4.68E-45 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 7.82E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 5.51E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 1.05E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327392349 NA 3.06E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251