Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0327336374:

Variant ID: vg0327336374 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 27336374
Reference Allele: CAAAAlternative Allele: AAAA,CAA,CAAAA,CA,C
Primary Allele: AAAASecondary Allele: CAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAATTTACTCCTACATTCGGTGTGCCGCGTTAGATCTCGCAAGCTGTCTGAATCCGAAAATGGATCATGCCAGCTCAGCTCGCATGTACTCCCTCTGTC[CAAA/AAAA,CAA,CAAAA,CA,C]
AAAAAAAAAGACAAACCCTGGTTTCTGTGTTTAACGTTTGACCATCCGTTTTATTTGAAAAAATTATGAAAAAAATTAAAAAGACAAGTCACGCATAAAA

Reverse complement sequence

TTTTATGCGTGACTTGTCTTTTTAATTTTTTTCATAATTTTTTCAAATAAAACGGATGGTCAAACGTTAAACACAGAAACCAGGGTTTGTCTTTTTTTTT[TTTG/TTTT,TTG,TTTTG,TG,G]
GACAGAGGGAGTACATGCGAGCTGAGCTGGCATGATCCATTTTCGGATTCAGACAGCTTGCGAGATCTAACGCGGCACACCGAATGTAGGAGTAAATTAT

Allele Frequencies:

Populations Population SizeFrequency of AAAA(primary allele) Frequency of CAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 18.50% 10.26% 0.44% CA: 9.27%; CAA: 7.79%; CAAAA: 0.21%; C: 0.13%
All Indica  2759 85.60% 1.30% 3.55% 0.00% CAA: 9.21%; CA: 0.25%; C: 0.04%
All Japonica  1512 1.70% 50.90% 11.51% 0.86% CA: 27.65%; CAA: 6.42%; CAAAA: 0.66%; C: 0.33%
Aus  269 18.60% 11.50% 67.29% 2.23% CAA: 0.37%
Indica I  595 65.90% 1.30% 0.17% 0.00% CAA: 32.44%; CA: 0.17%
Indica II  465 91.40% 1.50% 6.24% 0.00% CA: 0.43%; CAA: 0.43%
Indica III  913 94.90% 1.30% 3.07% 0.00% CAA: 0.66%; CA: 0.11%
Indica Intermediate  786 86.40% 1.30% 5.09% 0.00% CAA: 6.74%; CA: 0.38%; C: 0.13%
Temperate Japonica  767 1.20% 80.40% 12.26% 1.30% CA: 2.48%; CAA: 1.83%; CAAAA: 0.52%
Tropical Japonica  504 2.00% 12.90% 7.94% 0.00% CA: 70.04%; CAA: 5.36%; CAAAA: 1.19%; C: 0.60%
Japonica Intermediate  241 2.50% 36.50% 16.60% 1.24% CAA: 23.24%; CA: 19.09%; C: 0.83%
VI/Aromatic  96 45.80% 21.90% 18.75% 0.00% CAA: 12.50%; CA: 1.04%
Intermediate  90 46.70% 17.80% 15.56% 2.22% CA: 13.33%; CAA: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327336374 CAAA -> C LOC_Os03g48070.1 upstream_gene_variant ; 3452.0bp to feature; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> C LOC_Os03g48060.1 intron_variant ; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> CAAAA LOC_Os03g48070.1 upstream_gene_variant ; 3449.0bp to feature; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> CAAAA LOC_Os03g48060.1 intron_variant ; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> AAAA LOC_Os03g48070.1 upstream_gene_variant ; 3453.0bp to feature; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> AAAA LOC_Os03g48060.1 intron_variant ; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> CAA LOC_Os03g48070.1 upstream_gene_variant ; 3450.0bp to feature; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> CAA LOC_Os03g48060.1 intron_variant ; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> DEL N N silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> CA LOC_Os03g48070.1 upstream_gene_variant ; 3451.0bp to feature; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N
vg0327336374 CAAA -> CA LOC_Os03g48060.1 intron_variant ; MODIFIER silent_mutation Average:90.994; most accessible tissue: Zhenshan97 root, score: 97.467 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0327336374 CAAA AAAA -0.02 -0.02 -0.01 -0.02 -0.04 -0.05
vg0327336374 CAAA C -0.12 -0.18 0.06 -0.1 -0.12 0.0
vg0327336374 CAAA CA -0.02 -0.08 0.12 -0.02 -0.04 0.05
vg0327336374 CAAA CAA -0.01 0.01 0.11 -0.04 -0.03 0.06
vg0327336374 CAAA CAAAA 0.04 0.04 -0.04 0.03 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327336374 NA 2.91E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327336374 NA 2.91E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327336374 NA 8.39E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327336374 2.34E-06 NA mr1379_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327336374 NA 3.88E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327336374 NA 7.53E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251