\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0327302530:

Variant ID: vg0327302530 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 27302530
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


GGCAAAACCATCAAACTCTCGACGGCTTTTGTGGTTTTGCCACTACTATATGCAAGAAATAGTCTTTTTTTTTCTCTGCACAACCATTCAACAAAAATAT[A/C]
TCACAGAGAGGAAACCAAGCCCTCGCTGAATTCACTTGGCGAAAAAGCACGGAGATTCAGAGACCCAGCCAACGAAGGCCGACGAAGAAGACAAGTTTCA

Reverse complement sequence

TGAAACTTGTCTTCTTCGTCGGCCTTCGTTGGCTGGGTCTCTGAATCTCCGTGCTTTTTCGCCAAGTGAATTCAGCGAGGGCTTGGTTTCCTCTCTGTGA[T/G]
ATATTTTTGTTGAATGGTTGTGCAGAGAAAAAAAAAGACTATTTCTTGCATATAGTAGTGGCAAAACCACAAAAGCCGTCGAGAGTTTGATGGTTTTGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 10.00% 1.31% 0.00% NA
All Indica  2759 81.30% 16.60% 2.14% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.50% 0.30% 3.19% 0.00% NA
Indica II  465 52.00% 43.20% 4.73% 0.00% NA
Indica III  913 89.50% 10.30% 0.22% 0.00% NA
Indica Intermediate  786 77.50% 20.50% 2.04% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 8.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0327302530 A -> C LOC_Os03g48020.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:76.324; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0327302530 A -> C LOC_Os03g48020.2 splice_region_variant&intron_variant ; LOW silent_mutation Average:76.324; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0327302530 A -> C LOC_Os03g48010.1 downstream_gene_variant ; 1866.0bp to feature; MODIFIER silent_mutation Average:76.324; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0327302530 A -> C LOC_Os03g48030.1 intron_variant ; MODIFIER silent_mutation Average:76.324; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0327302530 A C -0.03 0.01 0.02 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0327302530 NA 1.28E-10 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0327302530 NA 5.00E-06 mr1046 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 4.17E-08 2.16E-13 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 8.05E-07 1.06E-12 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 NA 1.42E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 NA 5.86E-06 mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 1.11E-06 1.11E-06 mr1340 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 2.84E-06 2.82E-06 mr1429 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 NA 9.71E-07 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 NA 6.47E-07 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 1.28E-07 NA mr1514 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 2.16E-06 4.40E-08 mr1514 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 NA 6.94E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 NA 2.78E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 NA 3.37E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 1.38E-06 NA mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0327302530 NA 1.47E-08 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251