\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326986560:

Variant ID: vg0326986560 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26986560
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCGTTTTATTTTTTAAAAAAATATTAAAAAATAAAAGTAAAGTTACGCATAAATTACTATTCATATTTTATCATTCAATAATAATACTAATATTAATC[G/A]
TAAAAATATTTTAAATAAGACAGATGGTTAATTCATATTTTATCATTCAATAATAATACTAATATTAATCGTAAAAATATTTTAAATAAGACAGATGGTT

Reverse complement sequence

AACCATCTGTCTTATTTAAAATATTTTTACGATTAATATTAGTATTATTATTGAATGATAAAATATGAATTAACCATCTGTCTTATTTAAAATATTTTTA[C/T]
GATTAATATTAGTATTATTATTGAATGATAAAATATGAATAGTAATTTATGCGTAACTTTACTTTTATTTTTTAATATTTTTTTAAAAAATAAAACGGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.00% 0.10% 1.88% 80.96% NA
All Indica  2759 0.70% 0.00% 0.83% 98.44% NA
All Japonica  1512 50.80% 0.00% 0.40% 48.81% NA
Aus  269 0.00% 0.00% 5.20% 94.80% NA
Indica I  595 0.80% 0.00% 1.18% 97.98% NA
Indica II  465 0.90% 0.00% 0.43% 98.71% NA
Indica III  913 0.30% 0.00% 0.88% 98.80% NA
Indica Intermediate  786 0.90% 0.10% 0.76% 98.22% NA
Temperate Japonica  767 89.20% 0.00% 0.00% 10.82% NA
Tropical Japonica  504 1.40% 0.00% 0.79% 97.82% NA
Japonica Intermediate  241 32.00% 0.00% 0.83% 67.22% NA
VI/Aromatic  96 5.20% 4.20% 40.62% 50.00% NA
Intermediate  90 14.40% 1.10% 7.78% 76.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326986560 G -> A LOC_Os03g47650.1 upstream_gene_variant ; 1762.0bp to feature; MODIFIER silent_mutation Average:29.982; most accessible tissue: Callus, score: 72.39 N N N N
vg0326986560 G -> A LOC_Os03g47640.1 downstream_gene_variant ; 484.0bp to feature; MODIFIER silent_mutation Average:29.982; most accessible tissue: Callus, score: 72.39 N N N N
vg0326986560 G -> A LOC_Os03g47640-LOC_Os03g47650 intergenic_region ; MODIFIER silent_mutation Average:29.982; most accessible tissue: Callus, score: 72.39 N N N N
vg0326986560 G -> DEL N N silent_mutation Average:29.982; most accessible tissue: Callus, score: 72.39 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326986560 NA 3.39E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326986560 1.54E-06 7.08E-27 mr1115 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 4.49E-20 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 3.27E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 9.76E-10 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 3.78E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 4.32E-25 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 4.74E-16 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 2.21E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 9.22E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 3.41E-15 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 1.83E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 3.10E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 2.73E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 5.73E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 6.82E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 1.31E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 7.87E-14 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 1.31E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 2.74E-26 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 1.55E-16 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 4.37E-13 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 7.19E-22 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 6.75E-12 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560 NA 1.18E-08 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251