Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326986560:

Variant ID: vg0326986560 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 26986560
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

GTCCGTTTTATTTTTTAAAAAAATATTAAAAAATAAAAGTAAAGTTACGCATAAATTACTATTCATATTTTATCATTCAATAATAATACTAATATTAATC[G/A]
TAAAAATATTTTAAATAAGACAGATGGTTAATTCATATTTTATCATTCAATAATAATACTAATATTAATCGTAAAAATATTTTAAATAAGACAGATGGTT

Reverse complement sequence

AACCATCTGTCTTATTTAAAATATTTTTACGATTAATATTAGTATTATTATTGAATGATAAAATATGAATTAACCATCTGTCTTATTTAAAATATTTTTA[C/T]
GATTAATATTAGTATTATTATTGAATGATAAAATATGAATAGTAATTTATGCGTAACTTTACTTTTATTTTTTAATATTTTTTTAAAAAATAAAACGGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.00%	0.10%	1.88%	80.96%	NA
All Indica	2759	0.70%	0.00%	0.83%	98.44%	NA
All Japonica	1512	50.80%	0.00%	0.40%	48.81%	NA
Aus	269	0.00%	0.00%	5.20%	94.80%	NA
Indica I	595	0.80%	0.00%	1.18%	97.98%	NA
Indica II	465	0.90%	0.00%	0.43%	98.71%	NA
Indica III	913	0.30%	0.00%	0.88%	98.80%	NA
Indica Intermediate	786	0.90%	0.10%	0.76%	98.22%	NA
Temperate Japonica	767	89.20%	0.00%	0.00%	10.82%	NA
Tropical Japonica	504	1.40%	0.00%	0.79%	97.82%	NA
Japonica Intermediate	241	32.00%	0.00%	0.83%	67.22%	NA
VI/Aromatic	96	5.20%	4.20%	40.62%	50.00%	NA
Intermediate	90	14.40%	1.10%	7.78%	76.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0326986560	G -> A	LOC_Os03g47650.1	upstream_gene_variant ; 1762.0bp to feature; MODIFIER	silent_mutation	Average:29.982; most accessible tissue: Callus, score: 72.39	N	N	N	N
vg0326986560	G -> A	LOC_Os03g47640.1	downstream_gene_variant ; 484.0bp to feature; MODIFIER	silent_mutation	Average:29.982; most accessible tissue: Callus, score: 72.39	N	N	N	N
vg0326986560	G -> A	LOC_Os03g47640-LOC_Os03g47650	intergenic_region ; MODIFIER	silent_mutation	Average:29.982; most accessible tissue: Callus, score: 72.39	N	N	N	N
vg0326986560	G -> DEL	N	N	silent_mutation	Average:29.982; most accessible tissue: Callus, score: 72.39	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0326986560	NA	3.39E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326986560	1.54E-06	7.08E-27	mr1115	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	4.49E-20	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	3.27E-06	mr1205	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	9.76E-10	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	3.78E-07	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	4.32E-25	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	4.74E-16	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	2.21E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	9.22E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	3.41E-15	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	1.83E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	3.10E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	2.73E-12	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	5.73E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	6.82E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	1.31E-24	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	7.87E-14	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	1.31E-14	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	2.74E-26	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	1.55E-16	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	4.37E-13	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	7.19E-22	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	6.75E-12	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326986560	NA	1.18E-08	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251