\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326981451:

Variant ID: vg0326981451 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 26981451
Reference Allele: TCAlternative Allele: T,CC
Primary Allele: CCSecondary Allele: TC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGATTCAATATGTTAAATCAGTTCTGGAATGAACAATTCCAAAATTAAGAATGTCTACAAAAAAAAAGCTTATTCTTCACTATAACACAATTCCATGTTT[TC/T,CC]
CCCCCCTTGTTCTCAGGGAACGTTGGAATAGCACGACTGTTGTTATCTAAAGGAGCTAGTGTTGATGTATCTTCTTCTGAAGGGACACCACTTCATGTTG

Reverse complement sequence

CAACATGAAGTGGTGTCCCTTCAGAAGAAGATACATCAACACTAGCTCCTTTAGATAACAACAGTCGTGCTATTCCAACGTTCCCTGAGAACAAGGGGGG[GA/A,GG]
AAACATGGAATTGTGTTATAGTGAAGAATAAGCTTTTTTTTTGTAGACATTCTTAATTTTGGAATTGTTCATTCCAGAACTGATTTAACATATTGAATCG

Allele Frequencies:

Populations Population SizeFrequency of CC(primary allele) Frequency of TC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.00% 17.50% 13.44% 6.43% T: 14.68%
All Indica  2759 75.50% 0.70% 9.17% 0.11% T: 14.53%
All Japonica  1512 6.90% 51.30% 22.49% 18.98% T: 0.33%
Aus  269 14.50% 1.10% 1.12% 0.00% T: 83.27%
Indica I  595 47.60% 1.30% 21.51% 0.00% T: 29.58%
Indica II  465 89.20% 0.40% 7.10% 0.00% T: 3.23%
Indica III  913 88.60% 0.40% 1.42% 0.11% T: 9.42%
Indica Intermediate  786 73.20% 0.80% 10.05% 0.25% T: 15.78%
Temperate Japonica  767 1.40% 89.80% 5.35% 3.26% T: 0.13%
Tropical Japonica  504 14.30% 1.60% 43.85% 39.88% T: 0.40%
Japonica Intermediate  241 9.10% 32.40% 32.37% 25.31% T: 0.83%
VI/Aromatic  96 6.20% 13.50% 20.83% 10.42% T: 48.96%
Intermediate  90 40.00% 15.60% 21.11% 4.44% T: 18.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326981451 TC -> T LOC_Os03g47640.1 intron_variant ; MODIFIER silent_mutation Average:50.04; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0326981451 TC -> DEL N N silent_mutation Average:50.04; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N
vg0326981451 TC -> CC LOC_Os03g47640.1 intron_variant ; MODIFIER silent_mutation Average:50.04; most accessible tissue: Zhenshan97 young leaf, score: 63.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326981451 NA 5.52E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326981451 NA 4.65E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326981451 NA 6.11E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326981451 NA 2.26E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 3.93E-06 NA mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 2.25E-19 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 4.25E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.15E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 2.94E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 5.72E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 7.04E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 8.89E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.02E-07 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 7.98E-07 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.07E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.97E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 5.83E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.64E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 3.44E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.46E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 3.70E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.91E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.00E-12 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 7.11E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 2.01E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 2.80E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.22E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 5.78E-07 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 5.44E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.07E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 1.93E-06 2.08E-22 mr1920 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 2.33E-13 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 9.86E-09 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 6.98E-06 2.30E-07 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 2.03E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.24E-17 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 2.33E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 5.19E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 1.33E-14 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 2.51E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 7.28E-13 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326981451 NA 2.88E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251