\
| Variant ID: vg0326972463 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 26972463 |
| Reference Allele: TTTATTGTTTG | Alternative Allele: TTATTGTGCATCATTGAATTATTGTTTG,ATTATTGTTTG,T |
| Primary Allele: TTATTGTGCATCATTGAATT ATTGTTTG | Secondary Allele: TTTATTGTTTG |
Inferred Ancestral Allele: Not determined.
CTATAAATATATTGATTGCTATTCTATTATGGATCTTAAATGATTTTTTGATCGTTTCCTTGTTATTTATTTATTAAGTCACATCCATGTGCATCATTGA[TTTATTGTTTG/TTATTGTGCATCATTGAATTATTGTTTG,ATTATTGTTTG,T]
TTAGACTAAACCTGGTGAGGAGTGGGATCATTTAGTTTTGGTTAAATTATAGTGTAGATTAGTCGTCACGAAGCGAGGTACACATGTGCACAGTAGAAAT
ATTTCTACTGTGCACATGTGTACCTCGCTTCGTGACGACTAATCTACACTATAATTTAACCAAAACTAAATGATCCCACTCCTCACCAGGTTTAGTCTAA[CAAACAATAAA/CAAACAATAATTCAATGATGCACAATAA,CAAACAATAAT,A]
TCAATGATGCACATGGATGTGACTTAATAAATAAATAACAAGGAAACGATCAAAAAATCATTTAAGATCCATAATAGAATAGCAATCAATATATTTATAG
| Populations | Population Size | Frequency of TTATTGTGCATCATTGAATT ATTGTTTG(primary allele) | Frequency of TTTATTGTTTG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 35.10% | 1.44% | 0.11% | ATTATTGTTTG: 7.49%; T: 0.04% |
| All Indica | 2759 | 83.80% | 1.30% | 2.36% | 0.11% | ATTATTGTTTG: 12.47% |
| All Japonica | 1512 | 1.20% | 98.70% | 0.00% | 0.07% | ATTATTGTTTG: 0.07% |
| Aus | 269 | 95.50% | 3.30% | 0.00% | 0.00% | ATTATTGTTTG: 1.12% |
| Indica I | 595 | 87.40% | 1.00% | 5.55% | 0.17% | ATTATTGTTTG: 5.88% |
| Indica II | 465 | 80.60% | 1.50% | 2.15% | 0.00% | ATTATTGTTTG: 15.70% |
| Indica III | 913 | 85.30% | 0.90% | 0.55% | 0.11% | ATTATTGTTTG: 13.14% |
| Indica Intermediate | 786 | 81.00% | 1.90% | 2.16% | 0.13% | ATTATTGTTTG: 14.76% |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.60% | 98.00% | 0.00% | 0.20% | ATTATTGTTTG: 0.20% |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 85.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 44.40% | 2.22% | 1.11% | ATTATTGTTTG: 6.67%; T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0326972463 | TTTATTGTTTG -> T | LOC_Os03g47620.1 | downstream_gene_variant ; 2245.0bp to feature; MODIFIER | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326972463 | TTTATTGTTTG -> T | LOC_Os03g47629.1 | downstream_gene_variant ; 434.0bp to feature; MODIFIER | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326972463 | TTTATTGTTTG -> T | LOC_Os03g47629-LOC_Os03g47640 | intergenic_region ; MODIFIER | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326972463 | TTTATTGTTTG -> DEL | N | N | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326972463 | TTTATTGTTTG -> TTATTGTGCATCATTGAATTATTGTTTG | LOC_Os03g47620.1 | downstream_gene_variant ; 2246.0bp to feature; MODIFIER | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326972463 | TTTATTGTTTG -> TTATTGTGCATCATTGAATTATTGTTTG | LOC_Os03g47629.1 | downstream_gene_variant ; 435.0bp to feature; MODIFIER | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326972463 | TTTATTGTTTG -> TTATTGTGCATCATTGAATTATTGTTTG | LOC_Os03g47629-LOC_Os03g47640 | intergenic_region ; MODIFIER | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326972463 | TTTATTGTTTG -> ATTATTGTTTG | LOC_Os03g47620.1 | downstream_gene_variant ; 2244.0bp to feature; MODIFIER | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326972463 | TTTATTGTTTG -> ATTATTGTTTG | LOC_Os03g47629.1 | downstream_gene_variant ; 433.0bp to feature; MODIFIER | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326972463 | TTTATTGTTTG -> ATTATTGTTTG | LOC_Os03g47629-LOC_Os03g47640 | intergenic_region ; MODIFIER | silent_mutation | Average:49.733; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0326972463 | NA | 6.45E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | 4.12E-06 | 4.12E-06 | mr1197 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 3.10E-12 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 6.21E-09 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 1.32E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 4.04E-16 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 3.32E-12 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 9.21E-29 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 4.04E-16 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 1.59E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 1.75E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 7.05E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 1.12E-24 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 6.47E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 2.08E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 2.62E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 6.31E-14 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 5.86E-28 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 8.59E-12 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 4.12E-09 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 2.95E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 6.24E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 5.33E-11 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 4.67E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326972463 | NA | 7.51E-07 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |