\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326934528:

Variant ID: vg0326934528 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26934528
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACACATCTGCCGCGCGCGCCGCAAACGGGCGAGTGGGGTTAGTGGAGGCGTGGGCGCGAGAAACGAGGGGGCGAGGTAGTGGGCGCGGGAAGCGAGGAG[A/C]
CGGGCATAGCGTTGGCAAGGGAATAAAGACGCCGAGGAAGGGATTCGTTTCCTTCCCCTCGCCACTCTTCCCCTTGCCTTCGCCACTTGCGCTCTAACTC

Reverse complement sequence

GAGTTAGAGCGCAAGTGGCGAAGGCAAGGGGAAGAGTGGCGAGGGGAAGGAAACGAATCCCTTCCTCGGCGTCTTTATTCCCTTGCCAACGCTATGCCCG[T/G]
CTCCTCGCTTCCCGCGCCCACTACCTCGCCCCCTCGTTTCTCGCGCCCACGCCTCCACTAACCCCACTCGCCCGTTTGCGGCGCGCGCGGCAGATGTGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.30% 17.20% 14.90% 49.64% NA
All Indica  2759 2.80% 0.70% 16.46% 79.99% NA
All Japonica  1512 47.60% 51.10% 0.13% 1.26% NA
Aus  269 3.30% 0.40% 76.95% 19.33% NA
Indica I  595 3.00% 0.80% 13.78% 82.35% NA
Indica II  465 2.40% 0.90% 10.32% 86.45% NA
Indica III  913 2.70% 0.40% 20.81% 76.01% NA
Indica Intermediate  786 3.10% 0.90% 17.05% 79.01% NA
Temperate Japonica  767 9.80% 89.70% 0.00% 0.52% NA
Tropical Japonica  504 96.60% 1.40% 0.20% 1.79% NA
Japonica Intermediate  241 65.10% 32.00% 0.41% 2.49% NA
VI/Aromatic  96 37.50% 6.20% 27.08% 29.17% NA
Intermediate  90 23.30% 15.60% 16.67% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326934528 A -> C LOC_Os03g47590.1 upstream_gene_variant ; 165.0bp to feature; MODIFIER silent_mutation Average:29.976; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0326934528 A -> C LOC_Os03g47600.1 downstream_gene_variant ; 4018.0bp to feature; MODIFIER silent_mutation Average:29.976; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0326934528 A -> C LOC_Os03g47584-LOC_Os03g47590 intergenic_region ; MODIFIER silent_mutation Average:29.976; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0326934528 A -> DEL N N silent_mutation Average:29.976; most accessible tissue: Minghui63 root, score: 49.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326934528 NA 2.13E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0326934528 NA 7.37E-26 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 2.05E-19 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 3.36E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 1.55E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 2.28E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 8.27E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 4.29E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 2.69E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 7.01E-14 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 9.86E-25 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 6.85E-13 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 3.07E-29 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 2.33E-17 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 4.75E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 2.44E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 7.71E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 5.19E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 5.67E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 2.78E-06 4.29E-63 mr1241_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 2.47E-14 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 4.42E-25 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 6.51E-13 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 8.49E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 3.83E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326934528 NA 3.59E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251