\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326930904:

Variant ID: vg0326930904 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26930904
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


CACCTGCTTAAAATATGATTATCACAAGTAACATATAAATTATTAGTTGAGTTCTCTCTACAAGATCTTCCCACAGGATAAAATAAATACGATACCCTTG[G/A]
AATACTCTCGGGTGAAATGCTACAATGGTATATCCGTGCGCTTGCGGATGAACTCTGTAACCATAATATACCAGAAGTATTTCTGCGCCATTGTTGGGAA

Reverse complement sequence

TTCCCAACAATGGCGCAGAAATACTTCTGGTATATTATGGTTACAGAGTTCATCCGCAAGCGCACGGATATACCATTGTAGCATTTCACCCGAGAGTATT[C/T]
CAAGGGTATCGTATTTATTTTATCCTGTGGGAAGATCTTGTAGAGAGAACTCAACTAATAATTTATATGTTACTTGTGATAATCATATTTTAAGCAGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 4.70% 0.97% 0.00% NA
All Indica  2759 90.80% 7.60% 1.59% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.30% 1.80% 1.85% 0.00% NA
Indica II  465 77.00% 18.30% 4.73% 0.00% NA
Indica III  913 92.10% 7.70% 0.22% 0.00% NA
Indica Intermediate  786 93.10% 5.70% 1.15% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326930904 G -> A LOC_Os03g47584.1 upstream_gene_variant ; 4515.0bp to feature; MODIFIER silent_mutation Average:27.085; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0326930904 G -> A LOC_Os03g47590.1 upstream_gene_variant ; 3789.0bp to feature; MODIFIER silent_mutation Average:27.085; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0326930904 G -> A LOC_Os03g47584-LOC_Os03g47590 intergenic_region ; MODIFIER silent_mutation Average:27.085; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326930904 NA 6.74E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326930904 NA 1.07E-06 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326930904 1.79E-07 NA mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326930904 NA 1.26E-07 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326930904 3.08E-07 NA mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326930904 NA 9.49E-09 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251