\
| Variant ID: vg0326857364 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 26857364 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 96. )
ACTACTAGGAGCGCAGTATTCCGAGCGCCAAACATGTATCAGCTCAGGTCCACCTCACCCCACGTCCCGTCATCCCGCTCCCACAGTTATCAGAATAAAC[G/A]
ATTTACTACGATAAAAACAATTTCCATGCTTCCGATCCTACGCCACGTCCCGTCATCCCGCTCCCACCATTATCGAAGTAAACGATTTACTTTGATAAAA
TTTTATCAAAGTAAATCGTTTACTTCGATAATGGTGGGAGCGGGATGACGGGACGTGGCGTAGGATCGGAAGCATGGAAATTGTTTTTATCGTAGTAAAT[C/T]
GTTTATTCTGATAACTGTGGGAGCGGGATGACGGGACGTGGGGTGAGGTGGACCTGAGCTGATACATGTTTGGCGCTCGGAATACTGCGCTCCTAGTAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.90% | 47.00% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 21.10% | 78.80% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.70% | 80.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 18.30% | 81.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 18.90% | 80.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 26.50% | 73.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0326857364 | G -> A | LOC_Os03g47480.1 | upstream_gene_variant ; 233.0bp to feature; MODIFIER | silent_mutation | Average:45.528; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326857364 | G -> A | LOC_Os03g47490.1 | upstream_gene_variant ; 2189.0bp to feature; MODIFIER | silent_mutation | Average:45.528; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0326857364 | G -> A | LOC_Os03g47470-LOC_Os03g47480 | intergenic_region ; MODIFIER | silent_mutation | Average:45.528; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0326857364 | NA | 2.48E-09 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 2.70E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 1.81E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 1.75E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 2.13E-06 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 8.46E-53 | mr1063_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 2.04E-33 | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 2.98E-20 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 1.06E-34 | mr1221_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 9.03E-18 | mr1260_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 1.97E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326857364 | NA | 1.41E-06 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |