Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326857364:

Variant ID: vg0326857364 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26857364
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


ACTACTAGGAGCGCAGTATTCCGAGCGCCAAACATGTATCAGCTCAGGTCCACCTCACCCCACGTCCCGTCATCCCGCTCCCACAGTTATCAGAATAAAC[G/A]
ATTTACTACGATAAAAACAATTTCCATGCTTCCGATCCTACGCCACGTCCCGTCATCCCGCTCCCACCATTATCGAAGTAAACGATTTACTTTGATAAAA

Reverse complement sequence

TTTTATCAAAGTAAATCGTTTACTTCGATAATGGTGGGAGCGGGATGACGGGACGTGGCGTAGGATCGGAAGCATGGAAATTGTTTTTATCGTAGTAAAT[C/T]
GTTTATTCTGATAACTGTGGGAGCGGGATGACGGGACGTGGGGTGAGGTGGACCTGAGCTGATACATGTTTGGCGCTCGGAATACTGCGCTCCTAGTAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 47.00% 0.06% 0.00% NA
All Indica  2759 21.10% 78.80% 0.11% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 19.70% 80.30% 0.00% 0.00% NA
Indica II  465 18.30% 81.50% 0.22% 0.00% NA
Indica III  913 18.90% 80.90% 0.11% 0.00% NA
Indica Intermediate  786 26.50% 73.40% 0.13% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326857364 G -> A LOC_Os03g47480.1 upstream_gene_variant ; 233.0bp to feature; MODIFIER silent_mutation Average:45.528; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0326857364 G -> A LOC_Os03g47490.1 upstream_gene_variant ; 2189.0bp to feature; MODIFIER silent_mutation Average:45.528; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0326857364 G -> A LOC_Os03g47470-LOC_Os03g47480 intergenic_region ; MODIFIER silent_mutation Average:45.528; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326857364 NA 2.48E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 2.70E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 1.81E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 1.75E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 2.13E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 8.46E-53 mr1063_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 2.04E-33 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 2.98E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 1.06E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 9.03E-18 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 1.97E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326857364 NA 1.41E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251