Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326827276:

Variant ID: vg0326827276 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 26827276
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGTCTCGCGAATTAGCTTTCATTTATATAATTAGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAATGTCTAAATACAGGGTCTAAAGTTAAGT[C/A]
TCTGGATCCAAACACCGGGGGGGGGGCTAATGCGCGACTAGTCTAAAGTAGTGTCTAAACTTTATATATGATGTATACAGACTTTATATACAACGTGTAC

Reverse complement sequence

GTACACGTTGTATATAAAGTCTGTATACATCATATATAAAGTTTAGACACTACTTTAGACTAGTCGCGCATTAGCCCCCCCCCCGGTGTTTGGATCCAGA[G/T]
ACTTAACTTTAGACCCTGTATTTAGACATTAATTTAGAGTATTAAATATAGACTACTTACAAAACTAATTATATAAATGAAAGCTAATTCGCGAGACAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.30%	23.80%	0.89%	0.00%	NA
All Indica	2759	85.30%	14.20%	0.43%	0.00%	NA
All Japonica	1512	53.60%	44.60%	1.79%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	97.40%	2.20%	0.43%	0.00%	NA
Indica III	913	66.20%	33.50%	0.33%	0.00%	NA
Indica Intermediate	786	89.90%	9.30%	0.76%	0.00%	NA
Temperate Japonica	767	91.10%	7.00%	1.83%	0.00%	NA
Tropical Japonica	504	4.60%	95.20%	0.20%	0.00%	NA
Japonica Intermediate	241	36.50%	58.50%	4.98%	0.00%	NA
VI/Aromatic	96	65.60%	33.30%	1.04%	0.00%	NA
Intermediate	90	76.70%	21.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0326827276	C -> A	LOC_Os03g47470.1	upstream_gene_variant ; 3227.0bp to feature; MODIFIER	silent_mutation	Average:39.344; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0326827276	C -> A	LOC_Os03g47460-LOC_Os03g47470	intergenic_region ; MODIFIER	silent_mutation	Average:39.344; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0326827276	NA	1.63E-10	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	7.18E-06	mr1050	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	4.38E-11	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	1.08E-06	NA	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	7.48E-06	1.27E-19	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	6.06E-10	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	2.84E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	2.62E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	5.55E-06	6.29E-17	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	1.02E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	7.28E-14	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	5.02E-06	NA	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	3.67E-07	1.97E-16	mr1920	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	2.79E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	1.05E-07	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	3.86E-14	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	8.69E-18	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	4.72E-06	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	6.64E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	5.90E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	4.18E-13	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	9.67E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	1.93E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	1.28E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	1.14E-21	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326827276	NA	3.73E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251