\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326606264:

Variant ID: vg0326606264 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26606264
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTGCATATAAATTATATTTATTAGGGTTACCCAAAGGTGAAGATAATAGTATTTTTTCTTAATCTTTGTGTTAATGGTACTCGTACCTCTTATATTTT[G/A]
GAATAAGGAAAGTATATAAGTAGCATTTGTAGTGGTGCAAATAAAACTAGCAAGCCAAATTTCAGTTTACAATTAGTAACCCCTCCCTGTTGCTATCTGC

Reverse complement sequence

GCAGATAGCAACAGGGAGGGGTTACTAATTGTAAACTGAAATTTGGCTTGCTAGTTTTATTTGCACCACTACAAATGCTACTTATATACTTTCCTTATTC[C/T]
AAAATATAAGAGGTACGAGTACCATTAACACAAAGATTAAGAAAAAATACTATTATCTTCACCTTTGGGTAACCCTAATAAATATAATTTATATGCACCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 3.90% 0.08% 0.00% NA
All Indica  2759 93.50% 6.30% 0.11% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 71.60% 27.70% 0.65% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 97.20% 2.80% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326606264 G -> A LOC_Os03g47036.1 upstream_gene_variant ; 515.0bp to feature; MODIFIER silent_mutation Average:56.292; most accessible tissue: Callus, score: 88.926 N N N N
vg0326606264 G -> A LOC_Os03g47034.1 downstream_gene_variant ; 3516.0bp to feature; MODIFIER silent_mutation Average:56.292; most accessible tissue: Callus, score: 88.926 N N N N
vg0326606264 G -> A LOC_Os03g47042.1 downstream_gene_variant ; 2698.0bp to feature; MODIFIER silent_mutation Average:56.292; most accessible tissue: Callus, score: 88.926 N N N N
vg0326606264 G -> A LOC_Os03g47036-LOC_Os03g47042 intergenic_region ; MODIFIER silent_mutation Average:56.292; most accessible tissue: Callus, score: 88.926 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326606264 NA 7.87E-14 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 4.23E-08 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 2.56E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 1.82E-15 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 8.17E-11 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 6.37E-14 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 1.08E-14 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 3.33E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 1.11E-14 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 1.37E-10 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 8.37E-10 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 1.87E-06 1.87E-06 mr1562 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 2.81E-13 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 4.02E-15 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326606264 NA 2.18E-14 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251