\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326469301:

Variant ID: vg0326469301 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26469301
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TATCGCACAAGTTTAAAATGACTTGAACTTGAAATCAGATGGAGAACGCTATATAGTACATCTACATCAGGGGTTAATTAATATATACTACCTTCGTTTC[A/T]
GGTTAAAAGACTTTATAACACTACTCACATTCATATATATATTAATGAATCTAGTCACACATATATATCTAAATTCATTAACATATATATATGAATGTGG

Reverse complement sequence

CCACATTCATATATATATGTTAATGAATTTAGATATATATGTGTGACTAGATTCATTAATATATATATGAATGTGAGTAGTGTTATAAAGTCTTTTAACC[T/A]
GAAACGAAGGTAGTATATATTAATTAACCCCTGATGTAGATGTACTATATAGCGTTCTCCATCTGATTTCAAGTTCAAGTCATTTTAAACTTGTGCGATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 26.30% 0.15% 0.19% NA
All Indica  2759 55.60% 43.80% 0.25% 0.33% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 78.80% 20.70% 0.17% 0.34% NA
Indica II  465 14.40% 84.90% 0.43% 0.22% NA
Indica III  913 61.70% 37.90% 0.22% 0.22% NA
Indica Intermediate  786 55.50% 43.80% 0.25% 0.51% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326469301 A -> T LOC_Os03g46780.1 upstream_gene_variant ; 4929.0bp to feature; MODIFIER silent_mutation Average:42.484; most accessible tissue: Callus, score: 75.753 N N N N
vg0326469301 A -> T LOC_Os03g46790.1 downstream_gene_variant ; 2116.0bp to feature; MODIFIER silent_mutation Average:42.484; most accessible tissue: Callus, score: 75.753 N N N N
vg0326469301 A -> T LOC_Os03g46800.1 downstream_gene_variant ; 2473.0bp to feature; MODIFIER silent_mutation Average:42.484; most accessible tissue: Callus, score: 75.753 N N N N
vg0326469301 A -> T LOC_Os03g46790-LOC_Os03g46800 intergenic_region ; MODIFIER silent_mutation Average:42.484; most accessible tissue: Callus, score: 75.753 N N N N
vg0326469301 A -> DEL N N silent_mutation Average:42.484; most accessible tissue: Callus, score: 75.753 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326469301 NA 3.55E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301 NA 3.00E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301 NA 1.46E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301 NA 2.30E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301 NA 1.66E-07 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301 NA 6.00E-12 mr1557 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301 NA 5.51E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326469301 NA 7.15E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251