\
| Variant ID: vg0326469301 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 26469301 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, T: 0.02, others allele: 0.00, population size: 90. )
TATCGCACAAGTTTAAAATGACTTGAACTTGAAATCAGATGGAGAACGCTATATAGTACATCTACATCAGGGGTTAATTAATATATACTACCTTCGTTTC[A/T]
GGTTAAAAGACTTTATAACACTACTCACATTCATATATATATTAATGAATCTAGTCACACATATATATCTAAATTCATTAACATATATATATGAATGTGG
CCACATTCATATATATATGTTAATGAATTTAGATATATATGTGTGACTAGATTCATTAATATATATATGAATGTGAGTAGTGTTATAAAGTCTTTTAACC[T/A]
GAAACGAAGGTAGTATATATTAATTAACCCCTGATGTAGATGTACTATATAGCGTTCTCCATCTGATTTCAAGTTCAAGTCATTTTAAACTTGTGCGATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 26.30% | 0.15% | 0.19% | NA |
| All Indica | 2759 | 55.60% | 43.80% | 0.25% | 0.33% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 78.80% | 20.70% | 0.17% | 0.34% | NA |
| Indica II | 465 | 14.40% | 84.90% | 0.43% | 0.22% | NA |
| Indica III | 913 | 61.70% | 37.90% | 0.22% | 0.22% | NA |
| Indica Intermediate | 786 | 55.50% | 43.80% | 0.25% | 0.51% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0326469301 | A -> T | LOC_Os03g46780.1 | upstream_gene_variant ; 4929.0bp to feature; MODIFIER | silent_mutation | Average:42.484; most accessible tissue: Callus, score: 75.753 | N | N | N | N |
| vg0326469301 | A -> T | LOC_Os03g46790.1 | downstream_gene_variant ; 2116.0bp to feature; MODIFIER | silent_mutation | Average:42.484; most accessible tissue: Callus, score: 75.753 | N | N | N | N |
| vg0326469301 | A -> T | LOC_Os03g46800.1 | downstream_gene_variant ; 2473.0bp to feature; MODIFIER | silent_mutation | Average:42.484; most accessible tissue: Callus, score: 75.753 | N | N | N | N |
| vg0326469301 | A -> T | LOC_Os03g46790-LOC_Os03g46800 | intergenic_region ; MODIFIER | silent_mutation | Average:42.484; most accessible tissue: Callus, score: 75.753 | N | N | N | N |
| vg0326469301 | A -> DEL | N | N | silent_mutation | Average:42.484; most accessible tissue: Callus, score: 75.753 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0326469301 | NA | 3.55E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326469301 | NA | 3.00E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326469301 | NA | 1.46E-10 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326469301 | NA | 2.30E-06 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326469301 | NA | 1.66E-07 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326469301 | NA | 6.00E-12 | mr1557 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326469301 | NA | 5.51E-07 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326469301 | NA | 7.15E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |