\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326315822:

Variant ID: vg0326315822 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26315822
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATAGCAAAGAACCTTCAGATTTAGCCCTGTCTGCAAAAATCAATTTTTACAGATGAAGCCTTAAGAGATTCACATGTGAAAATACATTATTTTATAG[A/G]
CGGAACCTTAAGTGCTCCACCTGCAAAATACAAGAAGCCTATTAAATTTGGTTTAAGTCCCACTCCCTCACTCACCCTCCACCTCTCCATCCTTGTTCAC

Reverse complement sequence

GTGAACAAGGATGGAGAGGTGGAGGGTGAGTGAGGGAGTGGGACTTAAACCAAATTTAATAGGCTTCTTGTATTTTGCAGGTGGAGCACTTAAGGTTCCG[T/C]
CTATAAAATAATGTATTTTCACATGTGAATCTCTTAAGGCTTCATCTGTAAAAATTGATTTTTGCAGACAGGGCTAAATCTGAAGGTTCTTTGCTATTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 2.90% 1.78% 0.00% NA
All Indica  2759 99.30% 0.00% 0.72% 0.00% NA
All Japonica  1512 87.30% 8.70% 4.03% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 98.00% 0.00% 2.02% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 99.20% 0.00% 0.76% 0.00% NA
Temperate Japonica  767 78.90% 14.00% 7.17% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 88.00% 10.00% 2.07% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326315822 A -> G LOC_Os03g46490.1 upstream_gene_variant ; 2928.0bp to feature; MODIFIER silent_mutation Average:61.562; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0326315822 A -> G LOC_Os03g46510.1 upstream_gene_variant ; 1216.0bp to feature; MODIFIER silent_mutation Average:61.562; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0326315822 A -> G LOC_Os03g46500.1 downstream_gene_variant ; 375.0bp to feature; MODIFIER silent_mutation Average:61.562; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0326315822 A -> G LOC_Os03g46500-LOC_Os03g46510 intergenic_region ; MODIFIER silent_mutation Average:61.562; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326315822 NA 1.92E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326315822 NA 6.22E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326315822 NA 9.67E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326315822 NA 1.24E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326315822 NA 1.42E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326315822 NA 3.10E-08 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326315822 1.59E-06 1.59E-06 mr1899 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326315822 NA 8.39E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326315822 NA 6.83E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251