\
| Variant ID: vg0326113283 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 26113283 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATAGATGTGGGCAATGCTAGAAATTCTTACATTCTGAAACGAAGGAAGTACAATATTAATACCTGATTCCACCTGTCATACACAGATTACATCTTAGAGG[C/T]
TGTGCTCCGCTACTCTTCTTTCTTCTATTTTATTTTCTTAAAATATATTTACAGCTGACTTAGAGCAAGTATAATAGTAGGCTATAAGCCGGCTAAATGC
GCATTTAGCCGGCTTATAGCCTACTATTATACTTGCTCTAAGTCAGCTGTAAATATATTTTAAGAAAATAAAATAGAAGAAAGAAGAGTAGCGGAGCACA[G/A]
CCTCTAAGATGTAATCTGTGTATGACAGGTGGAATCAGGTATTAATATTGTACTTCCTTCGTTTCAGAATGTAAGAATTTCTAGCATTGCCCACATCTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 2.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 92.40% | 7.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 3.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.20% | 10.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0326113283 | C -> T | LOC_Os03g46170.1 | upstream_gene_variant ; 3828.0bp to feature; MODIFIER | silent_mutation | Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0326113283 | C -> T | LOC_Os03g46180.1 | upstream_gene_variant ; 1683.0bp to feature; MODIFIER | silent_mutation | Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0326113283 | C -> T | LOC_Os03g46190.1 | downstream_gene_variant ; 4216.0bp to feature; MODIFIER | silent_mutation | Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0326113283 | C -> T | LOC_Os03g46190.2 | downstream_gene_variant ; 2565.0bp to feature; MODIFIER | silent_mutation | Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| vg0326113283 | C -> T | LOC_Os03g46170-LOC_Os03g46180 | intergenic_region ; MODIFIER | silent_mutation | Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0326113283 | 5.26E-07 | 5.26E-07 | mr1085 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326113283 | NA | 6.36E-06 | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326113283 | NA | 4.67E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326113283 | NA | 7.71E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326113283 | NA | 5.41E-08 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326113283 | NA | 3.74E-06 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0326113283 | NA | 3.56E-07 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |