\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0326113283:

Variant ID: vg0326113283 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 26113283
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGATGTGGGCAATGCTAGAAATTCTTACATTCTGAAACGAAGGAAGTACAATATTAATACCTGATTCCACCTGTCATACACAGATTACATCTTAGAGG[C/T]
TGTGCTCCGCTACTCTTCTTTCTTCTATTTTATTTTCTTAAAATATATTTACAGCTGACTTAGAGCAAGTATAATAGTAGGCTATAAGCCGGCTAAATGC

Reverse complement sequence

GCATTTAGCCGGCTTATAGCCTACTATTATACTTGCTCTAAGTCAGCTGTAAATATATTTTAAGAAAATAAAATAGAAGAAAGAAGAGTAGCGGAGCACA[G/A]
CCTCTAAGATGTAATCTGTGTATGACAGGTGGAATCAGGTATTAATATTGTACTTCCTTCGTTTCAGAATGTAAGAATTTCTAGCATTGCCCACATCTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 2.40% 0.13% 0.00% NA
All Indica  2759 99.90% 0.00% 0.07% 0.00% NA
All Japonica  1512 92.40% 7.50% 0.13% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 96.10% 3.70% 0.26% 0.00% NA
Tropical Japonica  504 88.30% 11.70% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 10.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0326113283 C -> T LOC_Os03g46170.1 upstream_gene_variant ; 3828.0bp to feature; MODIFIER silent_mutation Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0326113283 C -> T LOC_Os03g46180.1 upstream_gene_variant ; 1683.0bp to feature; MODIFIER silent_mutation Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0326113283 C -> T LOC_Os03g46190.1 downstream_gene_variant ; 4216.0bp to feature; MODIFIER silent_mutation Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0326113283 C -> T LOC_Os03g46190.2 downstream_gene_variant ; 2565.0bp to feature; MODIFIER silent_mutation Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0326113283 C -> T LOC_Os03g46170-LOC_Os03g46180 intergenic_region ; MODIFIER silent_mutation Average:64.21; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0326113283 5.26E-07 5.26E-07 mr1085 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326113283 NA 6.36E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326113283 NA 4.67E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326113283 NA 7.71E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326113283 NA 5.41E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326113283 NA 3.74E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0326113283 NA 3.56E-07 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251