Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325734436:

Variant ID: vg0325734436 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 25734436
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATATTTTTAAGGAAAAAGTACGAATTACCCTCCTGAACTATCGCGGTCGACCGAATTACCCCCCTTAACCACAAAACTGGACATTCTTCACCCCTAA[C/T]
TGTACAAACTGGACAAATTACCCCCCTCAACCCAATCCACGGTGGTTTTAGTCTATGTGGCGTACACGTGGCAGTCCAGTCAGCATTCTAATTATAAAAA

Reverse complement sequence

TTTTTATAATTAGAATGCTGACTGGACTGCCACGTGTACGCCACATAGACTAAAACCACCGTGGATTGGGTTGAGGGGGGTAATTTGTCCAGTTTGTACA[G/A]
TTAGGGGTGAAGAATGTCCAGTTTTGTGGTTAAGGGGGGTAATTCGGTCGACCGCGATAGTTCAGGAGGGTAATTCGTACTTTTTCCTTAAAAATATATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	2.90%	1.46%	7.34%	NA
All Indica	2759	98.70%	0.20%	1.01%	0.11%	NA
All Japonica	1512	67.90%	8.60%	2.31%	21.23%	NA
Aus	269	98.90%	0.00%	0.37%	0.74%	NA
Indica I	595	97.00%	0.20%	2.86%	0.00%	NA
Indica II	465	97.80%	0.60%	1.29%	0.22%	NA
Indica III	913	99.80%	0.00%	0.11%	0.11%	NA
Indica Intermediate	786	99.20%	0.10%	0.51%	0.13%	NA
Temperate Japonica	767	66.60%	14.20%	3.78%	15.38%	NA
Tropical Japonica	504	77.40%	0.00%	0.99%	21.63%	NA
Japonica Intermediate	241	51.90%	8.70%	0.41%	39.00%	NA
VI/Aromatic	96	82.30%	0.00%	3.12%	14.58%	NA
Intermediate	90	88.90%	1.10%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0325734436	C -> T	LOC_Os03g45590.1	downstream_gene_variant ; 2313.0bp to feature; MODIFIER	silent_mutation	Average:59.276; most accessible tissue: Zhenshan97 young leaf, score: 78.938	N	N	N	N
vg0325734436	C -> T	LOC_Os03g45590-LOC_Os03g45619	intergenic_region ; MODIFIER	silent_mutation	Average:59.276; most accessible tissue: Zhenshan97 young leaf, score: 78.938	N	N	N	N
vg0325734436	C -> DEL	N	N	silent_mutation	Average:59.276; most accessible tissue: Zhenshan97 young leaf, score: 78.938	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0325734436	1.19E-12	1.19E-12	mr1166	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	3.82E-31	2.23E-36	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	9.24E-08	1.28E-06	mr1252	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	NA	3.53E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	2.42E-29	9.68E-35	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	6.86E-09	1.11E-09	mr1379	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	2.27E-15	2.27E-15	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	8.62E-11	5.00E-14	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	3.82E-13	7.42E-11	mr1559	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	7.64E-31	2.55E-36	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	2.55E-34	8.45E-39	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	1.81E-09	1.81E-09	mr1649	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	3.71E-06	3.71E-06	mr1703	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	4.38E-17	2.10E-21	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	NA	5.84E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	4.66E-07	2.36E-08	mr1793	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	5.09E-06	NA	mr1875	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	6.52E-09	6.52E-09	mr1166_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	2.31E-27	1.76E-31	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	4.07E-09	1.59E-07	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	1.96E-12	3.50E-14	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	3.94E-10	2.34E-10	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	6.84E-27	7.08E-35	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	4.08E-07	4.08E-07	mr1649_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	7.17E-10	1.94E-11	mr1703_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	8.55E-07	9.84E-10	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436	6.53E-08	3.30E-10	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251