\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325734436:

Variant ID: vg0325734436 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 25734436
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATATATTTTTAAGGAAAAAGTACGAATTACCCTCCTGAACTATCGCGGTCGACCGAATTACCCCCCTTAACCACAAAACTGGACATTCTTCACCCCTAA[C/T]
TGTACAAACTGGACAAATTACCCCCCTCAACCCAATCCACGGTGGTTTTAGTCTATGTGGCGTACACGTGGCAGTCCAGTCAGCATTCTAATTATAAAAA

Reverse complement sequence

TTTTTATAATTAGAATGCTGACTGGACTGCCACGTGTACGCCACATAGACTAAAACCACCGTGGATTGGGTTGAGGGGGGTAATTTGTCCAGTTTGTACA[G/A]
TTAGGGGTGAAGAATGTCCAGTTTTGTGGTTAAGGGGGGTAATTCGGTCGACCGCGATAGTTCAGGAGGGTAATTCGTACTTTTTCCTTAAAAATATATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.30% 2.90% 1.46% 7.34% NA
All Indica  2759 98.70% 0.20% 1.01% 0.11% NA
All Japonica  1512 67.90% 8.60% 2.31% 21.23% NA
Aus  269 98.90% 0.00% 0.37% 0.74% NA
Indica I  595 97.00% 0.20% 2.86% 0.00% NA
Indica II  465 97.80% 0.60% 1.29% 0.22% NA
Indica III  913 99.80% 0.00% 0.11% 0.11% NA
Indica Intermediate  786 99.20% 0.10% 0.51% 0.13% NA
Temperate Japonica  767 66.60% 14.20% 3.78% 15.38% NA
Tropical Japonica  504 77.40% 0.00% 0.99% 21.63% NA
Japonica Intermediate  241 51.90% 8.70% 0.41% 39.00% NA
VI/Aromatic  96 82.30% 0.00% 3.12% 14.58% NA
Intermediate  90 88.90% 1.10% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0325734436 C -> T LOC_Os03g45590.1 downstream_gene_variant ; 2313.0bp to feature; MODIFIER silent_mutation Average:59.276; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg0325734436 C -> T LOC_Os03g45590-LOC_Os03g45619 intergenic_region ; MODIFIER silent_mutation Average:59.276; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N
vg0325734436 C -> DEL N N silent_mutation Average:59.276; most accessible tissue: Zhenshan97 young leaf, score: 78.938 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0325734436 1.19E-12 1.19E-12 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 3.82E-31 2.23E-36 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 9.24E-08 1.28E-06 mr1252 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 NA 3.53E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 2.42E-29 9.68E-35 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 6.86E-09 1.11E-09 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 2.27E-15 2.27E-15 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 8.62E-11 5.00E-14 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 3.82E-13 7.42E-11 mr1559 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 7.64E-31 2.55E-36 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 2.55E-34 8.45E-39 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 1.81E-09 1.81E-09 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 3.71E-06 3.71E-06 mr1703 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 4.38E-17 2.10E-21 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 NA 5.84E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 4.66E-07 2.36E-08 mr1793 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 5.09E-06 NA mr1875 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 6.52E-09 6.52E-09 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 2.31E-27 1.76E-31 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 4.07E-09 1.59E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 1.96E-12 3.50E-14 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 3.94E-10 2.34E-10 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 6.84E-27 7.08E-35 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 4.08E-07 4.08E-07 mr1649_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 7.17E-10 1.94E-11 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 8.55E-07 9.84E-10 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325734436 6.53E-08 3.30E-10 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251