RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0325710457:

Variant ID: vg0325710457 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 25710457
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATCTTCTTTTTGTTTCCCAAAAGGGCACCGAGCATAGATAACAGAGCTTGTTATGTTACCACAAGTATAGCAGGGGGCACGCATACGGTTGAGTTGAG[G/T]
CATGTCTAGTGGTGGCGGCCACCATTGTTAATAGTACTCAACTTCCTACTTATTGATGCAATCATCTTTGAGGGTACCGATAGTGAACCAGGATTAATTA

Reverse complement sequence

TAATTAATCCTGGTTCACTATCGGTACCCTCAAAGATGATTGCATCAATAAGTAGGAAGTTGAGTACTATTAACAATGGTGGCCGCCACCACTAGACATG[C/A]
CTCAACTCAACCGTATGCGTGCCCCCTGCTATACTTGTGGTAACATAACAAGCTCTGTTATCTATGCTCGGTGCCCTTTTGGGAAACAAAAAGAAGATGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.80%	3.20%	1.65%	0.38%	NA
All Indica	2759	98.70%	0.10%	1.20%	0.00%	NA
All Japonica	1512	87.50%	9.70%	2.78%	0.00%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	97.30%	0.00%	2.69%	0.00%	NA
Indica II	465	98.10%	0.40%	1.51%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	0.10%	1.27%	0.00%	NA
Temperate Japonica	767	78.70%	16.40%	4.82%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.60%	0.00%	NA
Japonica Intermediate	241	90.50%	8.70%	0.83%	0.00%	NA
VI/Aromatic	96	84.40%	0.00%	2.08%	13.54%	NA
Intermediate	90	93.30%	1.10%	1.11%	4.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0325710457	G -> T	LOC_Os03g45560.1	upstream_gene_variant ; 4428.0bp to feature; MODIFIER	silent_mutation	Average:46.841; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg0325710457	G -> T	LOC_Os03g45560-LOC_Os03g45570	intergenic_region ; MODIFIER	silent_mutation	Average:46.841; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N
vg0325710457	G -> DEL	N	N	silent_mutation	Average:46.841; most accessible tissue: Zhenshan97 young leaf, score: 67.83	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0325710457	2.72E-13	2.72E-13	mr1166	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457	2.35E-31	2.20E-38	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457	1.71E-06	NA	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457	NA	4.32E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457	2.47E-32	6.18E-38	mr1305	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457	NA	5.25E-06	mr1358	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457	1.24E-09	4.63E-11	mr1379	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457	2.71E-18	2.71E-18	mr1409	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457	1.04E-11	1.94E-15	mr1515	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325710457	1.14E-12	7.63E-11	mr1559	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 26 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0325710457:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact