\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325705952:

Variant ID: vg0325705952 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 25705952
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGTCGTCGCCGTCCGTGGATCTTCCGCCGTTGTTTTGGTCACCGGTGAGTTCGCCGCGTCGCCCTCTACGTGCTGGTGCCCTCCGTTCGTGCCGTCGCG[C/T]
CGTCGTTCGCCGGCGAGCTGCACGCTCGAGCCGCCGCCGGTGGTGACGTCACCGCTGACGTCATCGTCGTCGTCCATCCGTGAGCCACGGTGGATCCGAT

Reverse complement sequence

ATCGGATCCACCGTGGCTCACGGATGGACGACGACGATGACGTCAGCGGTGACGTCACCACCGGCGGCGGCTCGAGCGTGCAGCTCGCCGGCGAACGACG[G/A]
CGCGACGGCACGAACGGAGGGCACCAGCACGTAGAGGGCGACGCGGCGAACTCACCGGTGACCAAAACAACGGCGGAAGATCCACGGACGGCGACGACGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.60% 3.00% 2.37% 6.98% NA
All Indica  2759 98.00% 0.10% 0.94% 0.98% NA
All Japonica  1512 67.50% 9.30% 5.03% 18.25% NA
Aus  269 89.60% 0.00% 2.23% 8.18% NA
Indica I  595 97.60% 0.00% 1.68% 0.67% NA
Indica II  465 98.50% 0.20% 1.29% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 95.70% 0.30% 1.15% 2.93% NA
Temperate Japonica  767 56.10% 15.50% 7.43% 20.99% NA
Tropical Japonica  504 87.10% 0.00% 1.79% 11.11% NA
Japonica Intermediate  241 62.70% 8.70% 4.15% 24.48% NA
VI/Aromatic  96 94.80% 0.00% 3.12% 2.08% NA
Intermediate  90 94.40% 1.10% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0325705952 C -> T LOC_Os03g45560.1 synonymous_variant ; p.Arg26Arg; LOW synonymous_codon Average:52.049; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg0325705952 C -> DEL LOC_Os03g45560.1 N frameshift_variant Average:52.049; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0325705952 2.12E-08 2.12E-08 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 5.93E-15 2.25E-21 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 1.02E-11 2.89E-18 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 NA 9.84E-06 mr1379 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 8.95E-13 8.95E-13 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 NA 5.72E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 3.01E-07 1.16E-06 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 6.65E-12 9.05E-19 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 2.07E-11 4.59E-18 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 3.97E-06 3.97E-06 mr1703 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 6.58E-09 3.38E-13 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 9.08E-08 9.08E-08 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 2.39E-16 4.63E-21 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 3.06E-07 8.72E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 5.99E-10 7.66E-12 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 1.65E-07 1.74E-08 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 1.08E-16 1.04E-25 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 1.72E-06 8.94E-08 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 4.13E-06 6.90E-09 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325705952 9.42E-07 9.87E-09 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251