\
| Variant ID: vg0325688031 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 25688031 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACTACTTTAAGATCTTTAACCATAGCAAACACTGTTTTCCCGCTGCGATGTTTAGGCTTCGTACGGTGGTCCGCCTTATATTCAAAGTGCTTGCCTTTC[A/T]
TCCGTACCGGGTGGTTTGCTGCAAGGAATCGACGATGACCCATGTACACAACCTTCCTAGAGTGCTTAAGATACATACTTTCTGTTTCATCCATACAGTG
CACTGTATGGATGAAACAGAAAGTATGTATCTTAAGCACTCTAGGAAGGTTGTGTACATGGGTCATCGTCGATTCCTTGCAGCAAACCACCCGGTACGGA[T/A]
GAAAGGCAAGCACTTTGAATATAAGGCGGACCACCGTACGAAGCCTAAACATCGCAGCGGGAAAACAGTGTTTGCTATGGTTAAAGATCTTAAAGTAGTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 13.30% | 4.30% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 0.90% | 1.81% | 0.00% | NA |
| All Japonica | 1512 | 59.80% | 33.60% | 6.61% | 0.00% | NA |
| Aus | 269 | 75.80% | 23.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.00% | 1.51% | 0.00% | NA |
| Indica II | 465 | 98.50% | 0.40% | 1.08% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.10% | 2.40% | 4.45% | 0.00% | NA |
| Temperate Japonica | 767 | 53.70% | 34.60% | 11.73% | 0.00% | NA |
| Tropical Japonica | 504 | 74.60% | 24.20% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 48.10% | 50.20% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 22.90% | 47.92% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 12.20% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0325688031 | A -> T | LOC_Os03g45519.1 | missense_variant ; p.Met633Lys; MODERATE | nonsynonymous_codon ; M633K | Average:43.745; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 | probably damaging |
-2.95 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0325688031 | 2.55E-06 | NA | mr1166 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 4.58E-07 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 5.15E-06 | 3.90E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 5.91E-08 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 3.08E-06 | 1.59E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 8.59E-07 | NA | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 7.46E-06 | NA | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 3.87E-09 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 1.56E-06 | 1.83E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 4.48E-07 | NA | mr1765 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | NA | 9.43E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 8.11E-07 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 4.14E-06 | NA | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 1.42E-06 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325688031 | 9.70E-07 | NA | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |