\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325666499:

Variant ID: vg0325666499 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 25666499
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCCCGTCACAGATGACCTATCTCTATCGGGCCACAACTAGCGCCCATCACAGATGACTACTAACCTTTATCGGGCCTAAACTAGAGCCCGTCACAGATG[A/T]
TACTCATCTCAATCGAGCCTAAACTATAGCCCGTCATAGATGACTGATGACCTCAATCGGGCCTAAATTAGAGCCCGTCACAGATGACTGCTGACCTCAA

Reverse complement sequence

TTGAGGTCAGCAGTCATCTGTGACGGGCTCTAATTTAGGCCCGATTGAGGTCATCAGTCATCTATGACGGGCTATAGTTTAGGCTCGATTGAGATGAGTA[T/A]
CATCTGTGACGGGCTCTAGTTTAGGCCCGATAAAGGTTAGTAGTCATCTGTGATGGGCGCTAGTTGTGGCCCGATAGAGATAGGTCATCTGTGACGGGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.60% 2.90% 0.04% 0.40% NA
All Indica  2759 98.00% 1.90% 0.04% 0.00% NA
All Japonica  1512 94.30% 5.70% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.60% 0.13% 0.00% NA
Temperate Japonica  767 89.00% 11.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 0.00% 0.00% 15.62% NA
Intermediate  90 95.60% 0.00% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0325666499 A -> T LOC_Os03g45480.1 downstream_gene_variant ; 560.0bp to feature; MODIFIER silent_mutation Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0325666499 A -> T LOC_Os03g45450-LOC_Os03g45480 intergenic_region ; MODIFIER silent_mutation Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N
vg0325666499 A -> DEL N N silent_mutation Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 69.681 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0325666499 NA 8.29E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325666499 NA 1.45E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325666499 NA 1.44E-06 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325666499 NA 3.07E-07 mr1875_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325666499 2.54E-07 2.54E-07 mr1908_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325666499 NA 4.89E-06 mr1994_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325666499 NA 4.06E-06 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251