Variant ID: vg0325666499 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 25666499 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCCCGTCACAGATGACCTATCTCTATCGGGCCACAACTAGCGCCCATCACAGATGACTACTAACCTTTATCGGGCCTAAACTAGAGCCCGTCACAGATG[A/T]
TACTCATCTCAATCGAGCCTAAACTATAGCCCGTCATAGATGACTGATGACCTCAATCGGGCCTAAATTAGAGCCCGTCACAGATGACTGCTGACCTCAA
TTGAGGTCAGCAGTCATCTGTGACGGGCTCTAATTTAGGCCCGATTGAGGTCATCAGTCATCTATGACGGGCTATAGTTTAGGCTCGATTGAGATGAGTA[T/A]
CATCTGTGACGGGCTCTAGTTTAGGCCCGATAAAGGTTAGTAGTCATCTGTGATGGGCGCTAGTTGTGGCCCGATAGAGATAGGTCATCTGTGACGGGCT
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.60% | 2.90% | 0.04% | 0.40% | NA |
All Indica | 2759 | 98.00% | 1.90% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 94.30% | 5.60% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 89.00% | 11.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 84.40% | 0.00% | 0.00% | 15.62% | NA |
Intermediate | 90 | 95.60% | 0.00% | 1.11% | 3.33% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0325666499 | A -> T | LOC_Os03g45480.1 | downstream_gene_variant ; 560.0bp to feature; MODIFIER | silent_mutation | Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
vg0325666499 | A -> T | LOC_Os03g45450-LOC_Os03g45480 | intergenic_region ; MODIFIER | silent_mutation | Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
vg0325666499 | A -> DEL | N | N | silent_mutation | Average:50.881; most accessible tissue: Minghui63 flag leaf, score: 69.681 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0325666499 | NA | 8.29E-06 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0325666499 | NA | 1.45E-06 | mr1380_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0325666499 | NA | 1.44E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0325666499 | NA | 3.07E-07 | mr1875_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0325666499 | 2.54E-07 | 2.54E-07 | mr1908_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0325666499 | NA | 4.89E-06 | mr1994_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0325666499 | NA | 4.06E-06 | mr1996_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |