\
| Variant ID: vg0325243401 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 25243401 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGACTTTCTTAGATTTAATGCATAACTCTCAATTCTTCCACACAAGATTGGCTATATGGGCATCGAGAAATGTAAATATTAATGAATCGCTTGTTTACGA[G/A]
GAATAACTAGTAGCATGTTTAAATAGATGATGAGTATAATTACTTATCCTTAATCTATGTGCCAAGATGATTGGAGTACAATAGATCAACTTTTTTTTTT
AAAAAAAAAAGTTGATCTATTGTACTCCAATCATCTTGGCACATAGATTAAGGATAAGTAATTATACTCATCATCTATTTAAACATGCTACTAGTTATTC[C/T]
TCGTAAACAAGCGATTCATTAATATTTACATTTCTCGATGCCCATATAGCCAATCTTGTGTGGAAGAATTGAGAGTTATGCATTAAATCTAAGAAAGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 16.60% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 94.20% | 5.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 75.60% | 24.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 8.60% | 91.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 5.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 82.10% | 17.50% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 73.00% | 27.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 60.20% | 39.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0325243401 | G -> A | LOC_Os03g44760.1 | downstream_gene_variant ; 3182.0bp to feature; MODIFIER | silent_mutation | Average:37.794; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0325243401 | G -> A | LOC_Os03g44760.4 | downstream_gene_variant ; 3244.0bp to feature; MODIFIER | silent_mutation | Average:37.794; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0325243401 | G -> A | LOC_Os03g44760.2 | downstream_gene_variant ; 3182.0bp to feature; MODIFIER | silent_mutation | Average:37.794; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0325243401 | G -> A | LOC_Os03g44760.5 | downstream_gene_variant ; 3244.0bp to feature; MODIFIER | silent_mutation | Average:37.794; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0325243401 | G -> A | LOC_Os03g44760.3 | downstream_gene_variant ; 3244.0bp to feature; MODIFIER | silent_mutation | Average:37.794; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0325243401 | G -> A | LOC_Os03g44760-LOC_Os03g44780 | intergenic_region ; MODIFIER | silent_mutation | Average:37.794; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0325243401 | 1.49E-08 | NA | mr1745 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325243401 | NA | 4.50E-07 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325243401 | 4.37E-08 | NA | mr1745_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325243401 | NA | 1.18E-09 | mr1745_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |