\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0325133506:

Variant ID: vg0325133506 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 25133506
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATATGATTTTTTAAAGCAACTTTTCTATAGAAATTGTTTGCAAAAAACACACCGTTTAGTAGTTCGGGAAGCGTGCGCGCAGAAAACAAAACTATCTT[T/C]
CTCTCTTTCTCCTGCGCTCGAACACAGGCTTAGGGTGTGTTTGAGAAGAAGGGGATTGAGGAGATTTGGAGATACGCAAAACGAGGTGAGCCATTAACTC

Reverse complement sequence

GAGTTAATGGCTCACCTCGTTTTGCGTATCTCCAAATCTCCTCAATCCCCTTCTTCTCAAACACACCCTAAGCCTGTGTTCGAGCGCAGGAGAAAGAGAG[A/G]
AAGATAGTTTTGTTTTCTGCGCGCACGCTTCCCGAACTACTAAACGGTGTGTTTTTTGCAAACAATTTCTATAGAAAAGTTGCTTTAAAAAATCATATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.00% 0.80% 0.23% 0.00% NA
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 97.00% 2.40% 0.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 94.00% 4.70% 1.30% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0325133506 T -> C LOC_Os03g44630.1 upstream_gene_variant ; 1715.0bp to feature; MODIFIER silent_mutation Average:21.626; most accessible tissue: Callus, score: 56.588 N N N N
vg0325133506 T -> C LOC_Os03g44636.1 upstream_gene_variant ; 2024.0bp to feature; MODIFIER silent_mutation Average:21.626; most accessible tissue: Callus, score: 56.588 N N N N
vg0325133506 T -> C LOC_Os03g44642.1 upstream_gene_variant ; 3628.0bp to feature; MODIFIER silent_mutation Average:21.626; most accessible tissue: Callus, score: 56.588 N N N N
vg0325133506 T -> C LOC_Os03g44620.2 downstream_gene_variant ; 2432.0bp to feature; MODIFIER silent_mutation Average:21.626; most accessible tissue: Callus, score: 56.588 N N N N
vg0325133506 T -> C LOC_Os03g44630-LOC_Os03g44636 intergenic_region ; MODIFIER silent_mutation Average:21.626; most accessible tissue: Callus, score: 56.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0325133506 4.84E-06 1.88E-06 mr1788 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325133506 9.55E-07 9.55E-07 mr1955 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0325133506 NA 5.23E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251