\
| Variant ID: vg0325018273 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 25018273 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCAACTTCTAAAATTTCCCAAATCTTGAGATCTATCTAGTGGCACGCTTAGAGGTCTTTAATAGGCTTTATTTTCGCCGTTTGTTGAGTTGTTCCGTTTC[G/A]
CGTGTAGTTCCGGAGCCCGAAGACCCGCAGTGCGAGGATTTCGAGCATCAAGCTCCGGATCGCGAGCAAGGCAAGCCACCTTTGAACATCTTGAGCCTAT
ATAGGCTCAAGATGTTCAAAGGTGGCTTGCCTTGCTCGCGATCCGGAGCTTGATGCTCGAAATCCTCGCACTGCGGGTCTTCGGGCTCCGGAACTACACG[C/T]
GAAACGGAACAACTCAACAAACGGCGAAAATAAAGCCTATTAAAGACCTCTAAGCGTGCCACTAGATAGATCTCAAGATTTGGGAAATTTTAGAAGTTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.70% | 8.00% | 6.14% | 54.08% | NA |
| All Indica | 2759 | 8.30% | 0.90% | 5.04% | 85.68% | NA |
| All Japonica | 1512 | 80.60% | 16.70% | 0.99% | 1.65% | NA |
| Aus | 269 | 5.60% | 1.10% | 45.72% | 47.58% | NA |
| Indica I | 595 | 15.50% | 0.00% | 4.03% | 80.50% | NA |
| Indica II | 465 | 2.40% | 1.30% | 1.51% | 94.84% | NA |
| Indica III | 913 | 3.60% | 0.90% | 5.81% | 89.70% | NA |
| Indica Intermediate | 786 | 12.00% | 1.50% | 7.00% | 79.52% | NA |
| Temperate Japonica | 767 | 98.40% | 0.40% | 0.52% | 0.65% | NA |
| Tropical Japonica | 504 | 47.60% | 47.00% | 2.18% | 3.17% | NA |
| Japonica Intermediate | 241 | 92.90% | 5.40% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 3.10% | 87.50% | 5.21% | 4.17% | NA |
| Intermediate | 90 | 36.70% | 15.60% | 8.89% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0325018273 | G -> A | LOC_Os03g44460.1 | downstream_gene_variant ; 3399.0bp to feature; MODIFIER | silent_mutation | Average:7.443; most accessible tissue: Callus, score: 18.01 | N | N | N | N |
| vg0325018273 | G -> A | LOC_Os03g44450-LOC_Os03g44460 | intergenic_region ; MODIFIER | silent_mutation | Average:7.443; most accessible tissue: Callus, score: 18.01 | N | N | N | N |
| vg0325018273 | G -> DEL | N | N | silent_mutation | Average:7.443; most accessible tissue: Callus, score: 18.01 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0325018273 | 1.06E-06 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 8.70E-08 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | NA | 1.56E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 1.70E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 3.75E-07 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 4.36E-06 | 4.55E-10 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | NA | 3.96E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 6.30E-07 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 4.55E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 8.96E-10 | NA | mr1082_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | NA | 3.58E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 1.32E-07 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 5.90E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 8.19E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 1.02E-07 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 1.28E-07 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | 5.89E-06 | 5.16E-11 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0325018273 | NA | 7.05E-06 | mr1763_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |