Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324949511:

Variant ID: vg0324949511 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24949511
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.42, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GGTTGTTTTAGTTCCTAGGACAAAATTGTATGGTTAGTGTAGTGTATGTATTAATTCACAACGGTCAAAGTATGTCTCATTCAGTCCTAGTTTATTATAT[C/T]
TTGGGGCAAAGAGAGTATCTTAGAGATTGTATAACCTCTAAGATAACCACATAGCTATATTTTGAGATAGAGAGAGTTTCTGTTTAGAGATTGTACAACC

Reverse complement sequence

GGTTGTACAATCTCTAAACAGAAACTCTCTCTATCTCAAAATATAGCTATGTGGTTATCTTAGAGGTTATACAATCTCTAAGATACTCTCTTTGCCCCAA[G/A]
ATATAATAAACTAGGACTGAATGAGACATACTTTGACCGTTGTGAATTAATACATACACTACACTAACCATACAATTTTGTCCTAGGAACTAAAACAACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	46.90%	0.17%	0.00%	NA
All Indica	2759	80.20%	19.50%	0.29%	0.00%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	83.60%	16.40%	0.00%	0.00%	NA
Indica I	595	71.80%	27.70%	0.50%	0.00%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	84.10%	15.70%	0.22%	0.00%	NA
Indica Intermediate	786	72.50%	27.10%	0.38%	0.00%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	46.70%	53.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324949511	C -> T	LOC_Os03g44370.1	upstream_gene_variant ; 895.0bp to feature; MODIFIER	silent_mutation	Average:47.783; most accessible tissue: Callus, score: 74.366	N	N	N	N
vg0324949511	C -> T	LOC_Os03g44370-LOC_Os03g44380	intergenic_region ; MODIFIER	silent_mutation	Average:47.783; most accessible tissue: Callus, score: 74.366	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324949511	NA	8.81E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	1.18E-07	NA	mr1671	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	NA	1.91E-09	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	NA	1.20E-33	mr1733	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	NA	1.40E-06	mr1733	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	NA	6.87E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	NA	9.53E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	1.58E-06	NA	mr1031_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	NA	2.95E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	NA	5.11E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	1.62E-06	NA	mr1671_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324949511	NA	2.12E-06	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251