\
| Variant ID: vg0324931493 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24931493 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.03, others allele: 0.00, population size: 117. )
GAGGCTCGGGAGCCGCCATCCTCCACCCCATCTACGCGGGAGGGCTCGGAAGCTGCTGTCGCCGCCATCATCGTCGTTGTCCTCATAGCAGACCCTGAAA[A/T]
TTTGACCAATAAAAACAAAACTCTAAAAATACGGACCTTCGAAAACTTTTAAATTAATTGCATCATGCCGATCTTATTCGCCTATTTTATTTGGATTTGA
TCAAATCCAAATAAAATAGGCGAATAAGATCGGCATGATGCAATTAATTTAAAAGTTTTCGAAGGTCCGTATTTTTAGAGTTTTGTTTTTATTGGTCAAA[T/A]
TTTCAGGGTCTGCTATGAGGACAACGACGATGATGGCGGCGACAGCAGCTTCCGAGCCCTCCCGCGTAGATGGGGTGGAGGATGGCGGCTCCCGAGCCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.50% | 43.30% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 27.20% | 72.50% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 29.70% | 69.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 6.50% | 93.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 29.50% | 70.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 34.90% | 64.60% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324931493 | A -> T | LOC_Os03g44340.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:55.005; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| vg0324931493 | A -> T | LOC_Os03g44330.1 | upstream_gene_variant ; 3390.0bp to feature; MODIFIER | silent_mutation | Average:55.005; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| vg0324931493 | A -> T | LOC_Os03g44350.1 | upstream_gene_variant ; 4162.0bp to feature; MODIFIER | silent_mutation | Average:55.005; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324931493 | NA | 9.26E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 3.06E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 7.40E-13 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 7.80E-11 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 8.42E-10 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 7.06E-08 | mr1671 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 2.12E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 9.83E-11 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | 4.83E-07 | NA | mr1013_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | 5.18E-08 | NA | mr1031_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 3.17E-12 | mr1330_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 4.14E-06 | mr1582_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324931493 | NA | 5.46E-19 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |