\
| Variant ID: vg0324795678 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24795678 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAATATGCTATCCTGATTTCTGTCCCCCTGAAATTTCAGCCTGTAGCCATTGACCCCACGAATTAACCAAAGACCAGATCGAATCAGTCGTGTAGAACTC[G/A]
AGTGAGAGCAAGTATAACAGTGAGATGTAACCTTACTATAATCTTACGTGGAGGAGAGAGGTAATAAAAAAAAATCAAAGGTGTTGTCTTTCATGCAAGA
TCTTGCATGAAAGACAACACCTTTGATTTTTTTTTATTACCTCTCTCCTCCACGTAAGATTATAGTAAGGTTACATCTCACTGTTATACTTGCTCTCACT[C/T]
GAGTTCTACACGACTGATTCGATCTGGTCTTTGGTTAATTCGTGGGGTCAATGGCTACAGGCTGAAATTTCAGGGGGACAGAAATCAGGATAGCATATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.90% | 4.20% | 10.22% | 35.65% | NA |
| All Indica | 2759 | 31.50% | 1.40% | 12.25% | 54.84% | NA |
| All Japonica | 1512 | 85.80% | 10.50% | 3.24% | 0.46% | NA |
| Aus | 269 | 18.60% | 0.00% | 31.23% | 50.19% | NA |
| Indica I | 595 | 68.40% | 1.30% | 6.72% | 23.53% | NA |
| Indica II | 465 | 9.00% | 0.60% | 5.81% | 84.52% | NA |
| Indica III | 913 | 14.90% | 0.00% | 19.61% | 65.50% | NA |
| Indica Intermediate | 786 | 36.00% | 3.70% | 11.70% | 48.60% | NA |
| Temperate Japonica | 767 | 76.70% | 18.40% | 4.43% | 0.52% | NA |
| Tropical Japonica | 504 | 98.20% | 0.00% | 1.39% | 0.40% | NA |
| Japonica Intermediate | 241 | 88.80% | 7.50% | 3.32% | 0.41% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 5.21% | 6.25% | NA |
| Intermediate | 90 | 64.40% | 1.10% | 7.78% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324795678 | G -> A | LOC_Os03g44130.1 | upstream_gene_variant ; 1161.0bp to feature; MODIFIER | silent_mutation | Average:51.083; most accessible tissue: Callus, score: 95.259 | N | N | N | N |
| vg0324795678 | G -> A | LOC_Os03g44140.1 | downstream_gene_variant ; 2126.0bp to feature; MODIFIER | silent_mutation | Average:51.083; most accessible tissue: Callus, score: 95.259 | N | N | N | N |
| vg0324795678 | G -> A | LOC_Os03g44130-LOC_Os03g44140 | intergenic_region ; MODIFIER | silent_mutation | Average:51.083; most accessible tissue: Callus, score: 95.259 | N | N | N | N |
| vg0324795678 | G -> DEL | N | N | silent_mutation | Average:51.083; most accessible tissue: Callus, score: 95.259 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324795678 | 2.84E-11 | NA | mr1210 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 2.70E-06 | 1.62E-09 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 3.77E-10 | NA | mr1305 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | NA | 4.66E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 3.26E-06 | NA | mr1379 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 1.30E-06 | NA | mr1409 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 5.11E-06 | 5.11E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 6.08E-06 | NA | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 5.66E-09 | 7.86E-09 | mr1585 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 5.18E-06 | 7.38E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 4.61E-15 | NA | mr1586 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 4.37E-07 | 1.85E-10 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 1.98E-09 | NA | mr1765 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | NA | 8.17E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 1.33E-08 | NA | mr1305_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 2.77E-06 | 1.43E-08 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 4.03E-06 | NA | mr1379_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 5.08E-07 | 1.88E-06 | mr1559_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 6.85E-06 | 6.95E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 5.63E-09 | 1.78E-08 | mr1585_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324795678 | 4.11E-06 | 4.73E-10 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |