\
| Variant ID: vg0324765360 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24765360 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCATTCGTTTTATTCAAAATTTTTGTGCAAATATGAAAATACTTATGTCATGCTTAAAGAACATTTGATGACGAATCAAGTCACAATGAAATAAATGATA[G/T]
CTACATAAATTTTTTTAATAAGACGAATGGTCAAACGTTGGACAAAAAGGCAACGGCGTCATACATTAAAATATGGAGGTAGTAAGTAACAAACATGATG
CATCATGTTTGTTACTTACTACCTCCATATTTTAATGTATGACGCCGTTGCCTTTTTGTCCAACGTTTGACCATTCGTCTTATTAAAAAAATTTATGTAG[C/A]
TATCATTTATTTCATTGTGACTTGATTCGTCATCAAATGTTCTTTAAGCATGACATAAGTATTTTCATATTTGCACAAAAATTTTGAATAAAACGAATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.40% | 13.80% | 2.16% | 7.66% | NA |
| All Indica | 2759 | 89.40% | 3.80% | 1.09% | 5.73% | NA |
| All Japonica | 1512 | 64.00% | 33.00% | 2.91% | 0.07% | NA |
| Aus | 269 | 18.60% | 2.60% | 8.92% | 69.89% | NA |
| Indica I | 595 | 97.00% | 1.30% | 1.18% | 0.50% | NA |
| Indica II | 465 | 97.40% | 0.40% | 0.22% | 1.94% | NA |
| Indica III | 913 | 84.10% | 2.40% | 1.20% | 12.27% | NA |
| Indica Intermediate | 786 | 85.00% | 9.30% | 1.40% | 4.33% | NA |
| Temperate Japonica | 767 | 74.30% | 22.30% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 43.70% | 53.40% | 2.78% | 0.20% | NA |
| Japonica Intermediate | 241 | 73.90% | 24.50% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 62.50% | 29.20% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 73.30% | 14.40% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324765360 | G -> T | LOC_Os03g44050.1 | upstream_gene_variant ; 1865.0bp to feature; MODIFIER | silent_mutation | Average:38.109; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0324765360 | G -> T | LOC_Os03g44070.1 | upstream_gene_variant ; 2987.0bp to feature; MODIFIER | silent_mutation | Average:38.109; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0324765360 | G -> T | LOC_Os03g44050-LOC_Os03g44070 | intergenic_region ; MODIFIER | silent_mutation | Average:38.109; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0324765360 | G -> DEL | N | N | silent_mutation | Average:38.109; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324765360 | NA | 5.18E-06 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324765360 | NA | 7.85E-07 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324765360 | 5.08E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324765360 | 1.24E-06 | 9.93E-07 | mr1586 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324765360 | NA | 2.16E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324765360 | 5.26E-06 | 1.42E-06 | mr1379_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324765360 | NA | 2.63E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324765360 | NA | 7.03E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324765360 | NA | 6.10E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |