\
| Variant ID: vg0324689010 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24689010 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )
TATATATCTCATTTATACGTGTTTAATTAAGTTGTATCTACGCTTGCCACGTATAAATAAGATCCAGGACAAGCACTTGTGCCAACTTACAGCTTTATAT[C/A]
AATAAAAACAATATGACATAAATTATTTAATTTGATTTGGAGATGGGTATTTCGGACAAAACAAGAATTGCCGAACAATATTTGTTATATATTTGGAGAT
ATCTCCAAATATATAACAAATATTGTTCGGCAATTCTTGTTTTGTCCGAAATACCCATCTCCAAATCAAATTAAATAATTTATGTCATATTGTTTTTATT[G/T]
ATATAAAGCTGTAAGTTGGCACAAGTGCTTGTCCTGGATCTTATTTATACGTGGCAAGCGTAGATACAACTTAATTAAACACGTATAAATGAGATATATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 21.10% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 64.90% | 35.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.00% | 15.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 19.60% | 80.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.40% | 24.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 64.40% | 35.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324689010 | C -> A | LOC_Os03g43960.1 | upstream_gene_variant ; 2136.0bp to feature; MODIFIER | silent_mutation | Average:39.414; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| vg0324689010 | C -> A | LOC_Os03g43970.1 | downstream_gene_variant ; 4291.0bp to feature; MODIFIER | silent_mutation | Average:39.414; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| vg0324689010 | C -> A | LOC_Os03g43960-LOC_Os03g43970 | intergenic_region ; MODIFIER | silent_mutation | Average:39.414; most accessible tissue: Callus, score: 79.609 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324689010 | NA | 3.01E-11 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0324689010 | NA | 1.91E-07 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 2.42E-07 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 2.94E-12 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 3.99E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 2.96E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 2.28E-13 | mr1188 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 4.28E-09 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 1.69E-06 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 2.47E-09 | mr1565 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 1.52E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 1.77E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 4.63E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 9.77E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 7.61E-13 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 8.34E-08 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 6.62E-08 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 9.41E-06 | mr1931_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324689010 | NA | 8.06E-07 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |