\
| Variant ID: vg0324646650 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 24646650 |
| Reference Allele: C | Alternative Allele: T,CTA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
AATTAAAGCATTAATTAGTCAATTAGGAGTAGATATGTATAAGTGAGGTGTGTGTATGTTTGTACTACTGCTACGCTATTAGAACATGTACGATAGCAAA[C/T,CTA]
TATAAGTCAGCTCTAAACGTATTTTAGGGAGATAGAATAGGATAGAGAAAAGCAGCGGGCTATAGATTTACAGCCAGCTGTAGCACGGACTTTTAAGATA
TATCTTAAAAGTCCGTGCTACAGCTGGCTGTAAATCTATAGCCCGCTGCTTTTCTCTATCCTATTCTATCTCCCTAAAATACGTTTAGAGCTGACTTATA[G/A,TAG]
TTTGCTATCGTACATGTTCTAATAGCGTAGCAGTAGTACAAACATACACACACCTCACTTATACATATCTACTCCTAATTGACTAATTAATGCTTTAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 15.10% | 0.44% | 0.02% | CTA: 0.02% |
| All Indica | 2759 | 74.10% | 25.20% | 0.72% | 0.04% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 2.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 56.10% | 43.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 88.40% | 10.50% | 1.08% | 0.00% | NA |
| Indica III | 913 | 80.20% | 19.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 72.10% | 26.80% | 0.89% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 0.00% | 0.00% | CTA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324646650 | C -> T | LOC_Os03g43920.1 | downstream_gene_variant ; 2045.0bp to feature; MODIFIER | silent_mutation | Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0324646650 | C -> T | LOC_Os03g43920-LOC_Os03g43930 | intergenic_region ; MODIFIER | silent_mutation | Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0324646650 | C -> CTA | LOC_Os03g43920.1 | downstream_gene_variant ; 2046.0bp to feature; MODIFIER | silent_mutation | Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0324646650 | C -> CTA | LOC_Os03g43920-LOC_Os03g43930 | intergenic_region ; MODIFIER | silent_mutation | Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| vg0324646650 | C -> DEL | N | N | silent_mutation | Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324646650 | NA | 1.72E-06 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0324646650 | NA | 3.39E-07 | mr1730 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324646650 | NA | 7.48E-08 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324646650 | NA | 4.06E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324646650 | NA | 5.69E-06 | mr1542_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |