\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324646650:

Variant ID: vg0324646650 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 24646650
Reference Allele: CAlternative Allele: T,CTA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAAAGCATTAATTAGTCAATTAGGAGTAGATATGTATAAGTGAGGTGTGTGTATGTTTGTACTACTGCTACGCTATTAGAACATGTACGATAGCAAA[C/T,CTA]
TATAAGTCAGCTCTAAACGTATTTTAGGGAGATAGAATAGGATAGAGAAAAGCAGCGGGCTATAGATTTACAGCCAGCTGTAGCACGGACTTTTAAGATA

Reverse complement sequence

TATCTTAAAAGTCCGTGCTACAGCTGGCTGTAAATCTATAGCCCGCTGCTTTTCTCTATCCTATTCTATCTCCCTAAAATACGTTTAGAGCTGACTTATA[G/A,TAG]
TTTGCTATCGTACATGTTCTAATAGCGTAGCAGTAGTACAAACATACACACACCTCACTTATACATATCTACTCCTAATTGACTAATTAATGCTTTAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 15.10% 0.44% 0.02% CTA: 0.02%
All Indica  2759 74.10% 25.20% 0.72% 0.04% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 97.00% 2.60% 0.37% 0.00% NA
Indica I  595 56.10% 43.00% 0.84% 0.00% NA
Indica II  465 88.40% 10.50% 1.08% 0.00% NA
Indica III  913 80.20% 19.50% 0.33% 0.00% NA
Indica Intermediate  786 72.10% 26.80% 0.89% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 0.00% 0.00% CTA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324646650 C -> T LOC_Os03g43920.1 downstream_gene_variant ; 2045.0bp to feature; MODIFIER silent_mutation Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0324646650 C -> T LOC_Os03g43920-LOC_Os03g43930 intergenic_region ; MODIFIER silent_mutation Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0324646650 C -> CTA LOC_Os03g43920.1 downstream_gene_variant ; 2046.0bp to feature; MODIFIER silent_mutation Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0324646650 C -> CTA LOC_Os03g43920-LOC_Os03g43930 intergenic_region ; MODIFIER silent_mutation Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N
vg0324646650 C -> DEL N N silent_mutation Average:66.708; most accessible tissue: Minghui63 panicle, score: 86.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324646650 NA 1.72E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0324646650 NA 3.39E-07 mr1730 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324646650 NA 7.48E-08 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324646650 NA 4.06E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324646650 NA 5.69E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251