\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324615779:

Variant ID: vg0324615779 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24615779
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAAAAGAAACTACACCTTCTTTTAGTGGAATTATTTTGTTATCTTTTCCTTTCTACTCCCTCCGTCCTCCAATATAAGAGATTTTTGTATTTTGTTTG[C/T]
ATTGTTTGACTATTCGTCTTATTAAAAAAAATTTGAAATTATTTTTTTTTGACTTACTTTATTATTCAAAGTACTTTAAGCAAAACTTTTTATTTTTTAT

Reverse complement sequence

ATAAAAAATAAAAAGTTTTGCTTAAAGTACTTTGAATAATAAAGTAAGTCAAAAAAAAATAATTTCAAATTTTTTTTAATAAGACGAATAGTCAAACAAT[G/A]
CAAACAAAATACAAAAATCTCTTATATTGGAGGACGGAGGGAGTAGAAAGGAAAAGATAACAAAATAATTCCACTAAAAGAAGGTGTAGTTTCTTTTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 47.80% 0.08% 0.00% NA
All Indica  2759 77.80% 22.10% 0.11% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 52.10% 47.70% 0.17% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 90.00% 9.90% 0.11% 0.00% NA
Indica Intermediate  786 71.90% 28.00% 0.13% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324615779 C -> T LOC_Os03g43880.1 downstream_gene_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:58.22; most accessible tissue: Callus, score: 83.817 N N N N
vg0324615779 C -> T LOC_Os03g43870-LOC_Os03g43880 intergenic_region ; MODIFIER silent_mutation Average:58.22; most accessible tissue: Callus, score: 83.817 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324615779 NA 1.23E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779 NA 1.08E-11 mr1595 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779 NA 5.79E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779 NA 5.30E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779 NA 5.84E-10 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779 NA 2.66E-06 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779 NA 6.76E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779 NA 9.96E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779 NA 1.80E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779 NA 7.69E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251