Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324615779:

Variant ID: vg0324615779 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24615779
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAAAAGAAACTACACCTTCTTTTAGTGGAATTATTTTGTTATCTTTTCCTTTCTACTCCCTCCGTCCTCCAATATAAGAGATTTTTGTATTTTGTTTG[C/T]
ATTGTTTGACTATTCGTCTTATTAAAAAAAATTTGAAATTATTTTTTTTTGACTTACTTTATTATTCAAAGTACTTTAAGCAAAACTTTTTATTTTTTAT

Reverse complement sequence

ATAAAAAATAAAAAGTTTTGCTTAAAGTACTTTGAATAATAAAGTAAGTCAAAAAAAAATAATTTCAAATTTTTTTTAATAAGACGAATAGTCAAACAAT[G/A]
CAAACAAAATACAAAAATCTCTTATATTGGAGGACGGAGGGAGTAGAAAGGAAAAGATAACAAAATAATTCCACTAAAAGAAGGTGTAGTTTCTTTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.10%	47.80%	0.08%	0.00%	NA
All Indica	2759	77.80%	22.10%	0.11%	0.00%	NA
All Japonica	1512	0.90%	99.10%	0.00%	0.00%	NA
Aus	269	94.80%	5.20%	0.00%	0.00%	NA
Indica I	595	52.10%	47.70%	0.17%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	90.00%	9.90%	0.11%	0.00%	NA
Indica Intermediate	786	71.90%	28.00%	0.13%	0.00%	NA
Temperate Japonica	767	0.70%	99.30%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	99.00%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	42.20%	56.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324615779	C -> T	LOC_Os03g43880.1	downstream_gene_variant ; 543.0bp to feature; MODIFIER	silent_mutation	Average:58.22; most accessible tissue: Callus, score: 83.817	N	N	N	N
vg0324615779	C -> T	LOC_Os03g43870-LOC_Os03g43880	intergenic_region ; MODIFIER	silent_mutation	Average:58.22; most accessible tissue: Callus, score: 83.817	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324615779	NA	1.23E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779	NA	1.08E-11	mr1595	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779	NA	5.79E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779	NA	5.30E-06	mr1671	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779	NA	5.84E-10	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779	NA	2.66E-06	mr1860	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779	NA	6.76E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779	NA	9.96E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779	NA	1.80E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324615779	NA	7.69E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251