\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324613201:

Variant ID: vg0324613201 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24613201
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGCAAATCGTATGAACTATTGTTTATGCTCTTAGGAGTTGAGGTCAAATACTAAGATTCCACGTAAAAATACGAATTAAAATGCTGTAGTTCCAATT[T/C]
TTTCATCCAGCAACCAATTTTAAATACCAAACCGGCTTTGTATAAAAAGTTCAGGATCAAATTCGAAGCCTTTTTATCGGTCTATAAACCGTTGTTCATC

Reverse complement sequence

GATGAACAACGGTTTATAGACCGATAAAAAGGCTTCGAATTTGATCCTGAACTTTTTATACAAAGCCGGTTTGGTATTTAAAATTGGTTGCTGGATGAAA[A/G]
AATTGGAACTACAGCATTTTAATTCGTATTTTTACGTGGAATCTTAGTATTTGACCTCAACTCCTAAGAGCATAAACAATAGTTCATACGATTTGCCTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 41.20% 0.13% 0.00% NA
All Indica  2759 88.70% 11.10% 0.18% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 85.70% 14.10% 0.17% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 91.50% 8.50% 0.00% 0.00% NA
Indica Intermediate  786 82.80% 16.70% 0.51% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324613201 T -> C LOC_Os03g43870.1 upstream_gene_variant ; 3231.0bp to feature; MODIFIER silent_mutation Average:35.226; most accessible tissue: Callus, score: 76.623 N N N N
vg0324613201 T -> C LOC_Os03g43880.1 downstream_gene_variant ; 3121.0bp to feature; MODIFIER silent_mutation Average:35.226; most accessible tissue: Callus, score: 76.623 N N N N
vg0324613201 T -> C LOC_Os03g43870-LOC_Os03g43880 intergenic_region ; MODIFIER silent_mutation Average:35.226; most accessible tissue: Callus, score: 76.623 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324613201 NA 3.73E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 2.15E-10 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 2.15E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 7.55E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 8.32E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 2.39E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 2.11E-27 mr1386_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 8.41E-07 mr1386_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 9.07E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 3.17E-06 mr1617_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613201 NA 9.44E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251