\
| Variant ID: vg0324613201 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24613201 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.42, others allele: 0.00, population size: 108. )
TTAGGCAAATCGTATGAACTATTGTTTATGCTCTTAGGAGTTGAGGTCAAATACTAAGATTCCACGTAAAAATACGAATTAAAATGCTGTAGTTCCAATT[T/C]
TTTCATCCAGCAACCAATTTTAAATACCAAACCGGCTTTGTATAAAAAGTTCAGGATCAAATTCGAAGCCTTTTTATCGGTCTATAAACCGTTGTTCATC
GATGAACAACGGTTTATAGACCGATAAAAAGGCTTCGAATTTGATCCTGAACTTTTTATACAAAGCCGGTTTGGTATTTAAAATTGGTTGCTGGATGAAA[A/G]
AATTGGAACTACAGCATTTTAATTCGTATTTTTACGTGGAATCTTAGTATTTGACCTCAACTCCTAAGAGCATAAACAATAGTTCATACGATTTGCCTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.60% | 41.20% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 88.70% | 11.10% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.70% | 14.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 82.80% | 16.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 47.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324613201 | T -> C | LOC_Os03g43870.1 | upstream_gene_variant ; 3231.0bp to feature; MODIFIER | silent_mutation | Average:35.226; most accessible tissue: Callus, score: 76.623 | N | N | N | N |
| vg0324613201 | T -> C | LOC_Os03g43880.1 | downstream_gene_variant ; 3121.0bp to feature; MODIFIER | silent_mutation | Average:35.226; most accessible tissue: Callus, score: 76.623 | N | N | N | N |
| vg0324613201 | T -> C | LOC_Os03g43870-LOC_Os03g43880 | intergenic_region ; MODIFIER | silent_mutation | Average:35.226; most accessible tissue: Callus, score: 76.623 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324613201 | NA | 3.73E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 2.15E-10 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 2.15E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 7.55E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 8.32E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 2.39E-07 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 2.11E-27 | mr1386_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 8.41E-07 | mr1386_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 9.07E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 3.17E-06 | mr1617_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613201 | NA | 9.44E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |