\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324613061:

Variant ID: vg0324613061 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24613061
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTCTTAATTTCATTTATATCACCGATTGTCTGTTGGAACAAATCATTGATTATAAAAAAAACTATTTGAAAAAGTAAGATAGTCAATTTGTTACACA[A/G]
CGTGTTTTATATGATTTCTACATGTGACGTGGAAATATTTTAGGCAAATCGTATGAACTATTGTTTATGCTCTTAGGAGTTGAGGTCAAATACTAAGATT

Reverse complement sequence

AATCTTAGTATTTGACCTCAACTCCTAAGAGCATAAACAATAGTTCATACGATTTGCCTAAAATATTTCCACGTCACATGTAGAAATCATATAAAACACG[T/C]
TGTGTAACAAATTGACTATCTTACTTTTTCAAATAGTTTTTTTTATAATCAATGATTTGTTCCAACAGACAATCGGTGATATAAATGAAATTAAGAGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.50% 41.30% 0.21% 0.00% NA
All Indica  2759 88.60% 11.10% 0.29% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 85.20% 14.10% 0.67% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 91.50% 8.50% 0.00% 0.00% NA
Indica Intermediate  786 83.00% 16.50% 0.51% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324613061 A -> G LOC_Os03g43870.1 upstream_gene_variant ; 3091.0bp to feature; MODIFIER silent_mutation Average:44.291; most accessible tissue: Callus, score: 78.417 N N N N
vg0324613061 A -> G LOC_Os03g43880.1 downstream_gene_variant ; 3261.0bp to feature; MODIFIER silent_mutation Average:44.291; most accessible tissue: Callus, score: 78.417 N N N N
vg0324613061 A -> G LOC_Os03g43870-LOC_Os03g43880 intergenic_region ; MODIFIER silent_mutation Average:44.291; most accessible tissue: Callus, score: 78.417 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324613061 NA 1.02E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613061 NA 1.12E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613061 NA 1.84E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613061 NA 1.38E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613061 NA 8.74E-27 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613061 NA 3.35E-06 mr1386_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324613061 4.60E-06 2.65E-06 mr1608_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251