\
| Variant ID: vg0324613061 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24613061 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 227. )
CATCTCTTAATTTCATTTATATCACCGATTGTCTGTTGGAACAAATCATTGATTATAAAAAAAACTATTTGAAAAAGTAAGATAGTCAATTTGTTACACA[A/G]
CGTGTTTTATATGATTTCTACATGTGACGTGGAAATATTTTAGGCAAATCGTATGAACTATTGTTTATGCTCTTAGGAGTTGAGGTCAAATACTAAGATT
AATCTTAGTATTTGACCTCAACTCCTAAGAGCATAAACAATAGTTCATACGATTTGCCTAAAATATTTCCACGTCACATGTAGAAATCATATAAAACACG[T/C]
TGTGTAACAAATTGACTATCTTACTTTTTCAAATAGTTTTTTTTATAATCAATGATTTGTTCCAACAGACAATCGGTGATATAAATGAAATTAAGAGATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.50% | 41.30% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 88.60% | 11.10% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.20% | 14.10% | 0.67% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.00% | 16.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 50.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324613061 | A -> G | LOC_Os03g43870.1 | upstream_gene_variant ; 3091.0bp to feature; MODIFIER | silent_mutation | Average:44.291; most accessible tissue: Callus, score: 78.417 | N | N | N | N |
| vg0324613061 | A -> G | LOC_Os03g43880.1 | downstream_gene_variant ; 3261.0bp to feature; MODIFIER | silent_mutation | Average:44.291; most accessible tissue: Callus, score: 78.417 | N | N | N | N |
| vg0324613061 | A -> G | LOC_Os03g43870-LOC_Os03g43880 | intergenic_region ; MODIFIER | silent_mutation | Average:44.291; most accessible tissue: Callus, score: 78.417 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324613061 | NA | 1.02E-09 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613061 | NA | 1.12E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613061 | NA | 1.84E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613061 | NA | 1.38E-06 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613061 | NA | 8.74E-27 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613061 | NA | 3.35E-06 | mr1386_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324613061 | 4.60E-06 | 2.65E-06 | mr1608_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |