\
| Variant ID: vg0324612598 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24612598 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 254. )
CCTAGGATGAGCAGAGAAGATGTCAACAATCTTCTCACTCGGACCAAAAGAAAGAAACACAACAGGGAATCCGAACTTAAAAACCTGGCTAGAAACGGTG[G/A]
ATCTACAAGGAGGAAGGAGGCCCAACCCCTCTCCCTCCCGTGGTCGGCGACGAGGCCACCGAAATCAAGGAAGAAGAGGGGTTGGAGTGGGAGGGATGTG
CACATCCCTCCCACTCCAACCCCTCTTCTTCCTTGATTTCGGTGGCCTCGTCGCCGACCACGGGAGGGAGAGGGGTTGGGCCTCCTTCCTCCTTGTAGAT[C/T]
CACCGTTTCTAGCCAGGTTTTTAAGTTCGGATTCCCTGTTGTGTTTCTTTCTTTTGGTCCGAGTGAGAAGATTGTTGACATCTTCTCTGCTCATCCTAGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 44.70% | 0.17% | 0.11% | NA |
| All Indica | 2759 | 86.20% | 13.60% | 0.11% | 0.11% | NA |
| All Japonica | 1512 | 0.90% | 99.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 62.10% | 37.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 85.20% | 14.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.50% | 13.40% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 81.20% | 18.20% | 0.38% | 0.25% | NA |
| Temperate Japonica | 767 | 0.50% | 99.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 98.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 51.10% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324612598 | G -> A | LOC_Os03g43870.1 | upstream_gene_variant ; 2628.0bp to feature; MODIFIER | silent_mutation | Average:60.483; most accessible tissue: Zhenshan97 young leaf, score: 80.325 | N | N | N | N |
| vg0324612598 | G -> A | LOC_Os03g43880.1 | downstream_gene_variant ; 3724.0bp to feature; MODIFIER | silent_mutation | Average:60.483; most accessible tissue: Zhenshan97 young leaf, score: 80.325 | N | N | N | N |
| vg0324612598 | G -> A | LOC_Os03g43870-LOC_Os03g43880 | intergenic_region ; MODIFIER | silent_mutation | Average:60.483; most accessible tissue: Zhenshan97 young leaf, score: 80.325 | N | N | N | N |
| vg0324612598 | G -> DEL | N | N | silent_mutation | Average:60.483; most accessible tissue: Zhenshan97 young leaf, score: 80.325 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324612598 | NA | 1.74E-10 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | NA | 5.78E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | NA | 9.46E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | NA | 2.57E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | NA | 1.21E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | NA | 3.09E-09 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | NA | 1.62E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | NA | 1.50E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | 1.80E-06 | 5.43E-28 | mr1386_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | NA | 4.50E-06 | mr1386_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | NA | 4.13E-09 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324612598 | 2.64E-06 | NA | mr1608_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |