\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324612598:

Variant ID: vg0324612598 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24612598
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAGGATGAGCAGAGAAGATGTCAACAATCTTCTCACTCGGACCAAAAGAAAGAAACACAACAGGGAATCCGAACTTAAAAACCTGGCTAGAAACGGTG[G/A]
ATCTACAAGGAGGAAGGAGGCCCAACCCCTCTCCCTCCCGTGGTCGGCGACGAGGCCACCGAAATCAAGGAAGAAGAGGGGTTGGAGTGGGAGGGATGTG

Reverse complement sequence

CACATCCCTCCCACTCCAACCCCTCTTCTTCCTTGATTTCGGTGGCCTCGTCGCCGACCACGGGAGGGAGAGGGGTTGGGCCTCCTTCCTCCTTGTAGAT[C/T]
CACCGTTTCTAGCCAGGTTTTTAAGTTCGGATTCCCTGTTGTGTTTCTTTCTTTTGGTCCGAGTGAGAAGATTGTTGACATCTTCTCTGCTCATCCTAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 44.70% 0.17% 0.11% NA
All Indica  2759 86.20% 13.60% 0.11% 0.11% NA
All Japonica  1512 0.90% 99.00% 0.13% 0.00% NA
Aus  269 62.10% 37.50% 0.37% 0.00% NA
Indica I  595 85.20% 14.80% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 86.50% 13.40% 0.00% 0.11% NA
Indica Intermediate  786 81.20% 18.20% 0.38% 0.25% NA
Temperate Japonica  767 0.50% 99.30% 0.13% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 44.40% 51.10% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324612598 G -> A LOC_Os03g43870.1 upstream_gene_variant ; 2628.0bp to feature; MODIFIER silent_mutation Average:60.483; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0324612598 G -> A LOC_Os03g43880.1 downstream_gene_variant ; 3724.0bp to feature; MODIFIER silent_mutation Average:60.483; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0324612598 G -> A LOC_Os03g43870-LOC_Os03g43880 intergenic_region ; MODIFIER silent_mutation Average:60.483; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N
vg0324612598 G -> DEL N N silent_mutation Average:60.483; most accessible tissue: Zhenshan97 young leaf, score: 80.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324612598 NA 1.74E-10 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 NA 5.78E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 NA 9.46E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 NA 2.57E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 NA 1.21E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 NA 3.09E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 NA 1.62E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 NA 1.50E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 1.80E-06 5.43E-28 mr1386_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 NA 4.50E-06 mr1386_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 NA 4.13E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324612598 2.64E-06 NA mr1608_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251