\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324605333:

Variant ID: vg0324605333 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24605333
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TTATTCGGACGACCTTTGATGGATACGTGCTCTATATTAAAGTTGTAGAGCTGGACGGGATGTACTACTTTGTAGTTCATGATATTTCCATTTGAAATTA[T/C]
CTAAACCACATAAAAACATTATAAGTTTTGAAGAGAAAAAAATGAGTAGCATTTACAATCAAGATAAGCTTGATAAGTGAGAGGTAAGTAAGCCATGCAT

Reverse complement sequence

ATGCATGGCTTACTTACCTCTCACTTATCAAGCTTATCTTGATTGTAAATGCTACTCATTTTTTTCTCTTCAAAACTTATAATGTTTTTATGTGGTTTAG[A/G]
TAATTTCAAATGGAAATATCATGAACTACAAAGTAGTACATCCCGTCCAGCTCTACAACTTTAATATAGAGCACGTATCCATCAAAGGTCGTCCGAATAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.90% 0.00% 0.00% NA
All Indica  2759 95.10% 4.90% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.70% 14.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324605333 T -> C LOC_Os03g43860.1 upstream_gene_variant ; 4957.0bp to feature; MODIFIER silent_mutation Average:32.064; most accessible tissue: Callus, score: 53.556 N N N N
vg0324605333 T -> C LOC_Os03g43870.1 downstream_gene_variant ; 4107.0bp to feature; MODIFIER silent_mutation Average:32.064; most accessible tissue: Callus, score: 53.556 N N N N
vg0324605333 T -> C LOC_Os03g43860-LOC_Os03g43870 intergenic_region ; MODIFIER silent_mutation Average:32.064; most accessible tissue: Callus, score: 53.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324605333 4.50E-06 4.50E-06 mr1286_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324605333 8.62E-06 8.62E-06 mr1312_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324605333 2.61E-06 2.61E-06 mr1634_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324605333 1.16E-06 1.16E-06 mr1665_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324605333 6.77E-06 6.77E-06 mr1738_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324605333 NA 3.32E-06 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251