\
| Variant ID: vg0324586813 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24586813 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGTAGTATTTAGTAATGTAAGCATGATGTTTAGATTATTAGATACTATTAAATGGTGCTATATGCTACGGATCTATAAAGGTAGGCCGCTGATAGTGACA[G/T]
CTCAGTATCTATATAGGGCTAAGAGATTTTTCCTAGTGTGGTTACTCCTCCGTATCTATTACTAGTTGGATAACCATGACGAATTGTCATAAGAAACTGG
CCAGTTTCTTATGACAATTCGTCATGGTTATCCAACTAGTAATAGATACGGAGGAGTAACCACACTAGGAAAAATCTCTTAGCCCTATATAGATACTGAG[C/A]
TGTCACTATCAGCGGCCTACCTTTATAGATCCGTAGCATATAGCACCATTTAATAGTATCTAATAATCTAAACATCATGCTTACATTACTAAATACTACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.50% | 9.40% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 72.10% | 27.60% | 0.26% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 3.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 30.20% | 69.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.00% | 16.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 7.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324586813 | G -> T | LOC_Os03g43850.1 | upstream_gene_variant ; 4577.0bp to feature; MODIFIER | silent_mutation | Average:46.297; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| vg0324586813 | G -> T | LOC_Os03g43840-LOC_Os03g43850 | intergenic_region ; MODIFIER | silent_mutation | Average:46.297; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324586813 | NA | 9.26E-20 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324586813 | 2.58E-06 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324586813 | 3.99E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324586813 | 2.82E-06 | 1.02E-10 | mr1993 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324586813 | NA | 3.26E-09 | mr1993 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324586813 | NA | 3.76E-21 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324586813 | NA | 2.31E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324586813 | NA | 2.15E-11 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |