Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324586813:

Variant ID: vg0324586813 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24586813
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAGTATTTAGTAATGTAAGCATGATGTTTAGATTATTAGATACTATTAAATGGTGCTATATGCTACGGATCTATAAAGGTAGGCCGCTGATAGTGACA[G/T]
CTCAGTATCTATATAGGGCTAAGAGATTTTTCCTAGTGTGGTTACTCCTCCGTATCTATTACTAGTTGGATAACCATGACGAATTGTCATAAGAAACTGG

Reverse complement sequence

CCAGTTTCTTATGACAATTCGTCATGGTTATCCAACTAGTAATAGATACGGAGGAGTAACCACACTAGGAAAAATCTCTTAGCCCTATATAGATACTGAG[C/A]
TGTCACTATCAGCGGCCTACCTTTATAGATCCGTAGCATATAGCACCATTTAATAGTATCTAATAATCTAAACATCATGCTTACATTACTAAATACTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.50% 9.40% 0.13% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 72.10% 27.60% 0.26% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 96.20% 3.70% 0.13% 0.00% NA
Tropical Japonica  504 30.20% 69.40% 0.40% 0.00% NA
Japonica Intermediate  241 83.00% 16.60% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324586813 G -> T LOC_Os03g43850.1 upstream_gene_variant ; 4577.0bp to feature; MODIFIER silent_mutation Average:46.297; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0324586813 G -> T LOC_Os03g43840-LOC_Os03g43850 intergenic_region ; MODIFIER silent_mutation Average:46.297; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324586813 NA 9.26E-20 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324586813 2.58E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324586813 3.99E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324586813 2.82E-06 1.02E-10 mr1993 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324586813 NA 3.26E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324586813 NA 3.76E-21 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324586813 NA 2.31E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324586813 NA 2.15E-11 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251