Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324236046:

Variant ID: vg0324236046 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24236046
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAGGGTAAGTCCAATGTTCCGTCGGCCCAGGCAATTGTATTGTTTACGTCGGCGTTGTTTAAGGCTGCATCAATACATTCGACCTCTTGGATTGCTCT[A/G]
GTTTGGATGACACATTTGCCTACCTATTTATCATATGTCTATGTTAATCTAGTCTTAGCATATCAATTTAGCTCTATCGGCTGCTTCTCGTTTTAGGGTT

Reverse complement sequence

AACCCTAAAACGAGAAGCAGCCGATAGAGCTAAATTGATATGCTAAGACTAGATTAACATAGACATATGATAAATAGGTAGGCAAATGTGTCATCCAAAC[T/C]
AGAGCAATCCAAGAGGTCGAATGTATTGATGCAGCCTTAAACAACGCCGACGTAAACAATACAATTGCCTGGGCCGACGGAACATTGGACTTACCCTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.20%	20.00%	0.83%	0.00%	NA
All Indica	2759	99.40%	0.50%	0.07%	0.00%	NA
All Japonica	1512	43.50%	54.40%	2.12%	0.00%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.10%	0.25%	0.00%	NA
Temperate Japonica	767	8.70%	89.00%	2.22%	0.00%	NA
Tropical Japonica	504	86.50%	11.90%	1.59%	0.00%	NA
Japonica Intermediate	241	64.30%	32.80%	2.90%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	73.30%	22.20%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324236046	A -> G	LOC_Os03g43460.1	downstream_gene_variant ; 4024.0bp to feature; MODIFIER	silent_mutation	Average:30.363; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0324236046	A -> G	LOC_Os03g43440-LOC_Os03g43460	intergenic_region ; MODIFIER	silent_mutation	Average:30.363; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324236046	NA	7.46E-21	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	9.13E-08	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	5.22E-06	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	6.80E-06	9.23E-06	mr1890	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	2.33E-06	2.33E-06	mr1891	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	3.71E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	6.62E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	2.22E-07	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	3.57E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	4.13E-07	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	1.87E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	5.22E-18	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324236046	NA	1.25E-07	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251