Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324235711:

Variant ID: vg0324235711 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24235711
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAGTTGTTGGTTCAAGGATAAGTTTGAACTAAAATGAAAACTTGAAGGACTAATATGGATAGATTGAAACATCAAGGACTAAACTGAGCCTCAGATGA[G/A]
ACTTGGAGGACCACTTTGGCTATTCACCCTTTATCTTTAGGAAAGTTTCTTTCTTGTCGTACAAGGACTAGTATCTACCCATGGGTATAAATATGTACAC

Reverse complement sequence

GTGTACATATTTATACCCATGGGTAGATACTAGTCCTTGTACGACAAGAAAGAAACTTTCCTAAAGATAAAGGGTGAATAGCCAAAGTGGTCCTCCAAGT[C/T]
TCATCTGAGGCTCAGTTTAGTCCTTGATGTTTCAATCTATCCATATTAGTCCTTCAAGTTTTCATTTTAGTTCAAACTTATCCTTGAACCAACAACTCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.40%	37.20%	0.38%	0.02%	NA
All Indica	2759	98.30%	1.30%	0.36%	0.04%	NA
All Japonica	1512	0.90%	98.80%	0.26%	0.00%	NA
Aus	269	66.50%	33.50%	0.00%	0.00%	NA
Indica I	595	99.30%	0.20%	0.50%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.20%	0.40%	0.33%	0.00%	NA
Indica Intermediate	786	96.20%	3.20%	0.51%	0.13%	NA
Temperate Japonica	767	0.50%	99.30%	0.13%	0.00%	NA
Tropical Japonica	504	1.20%	98.40%	0.40%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	46.70%	48.90%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324235711	G -> A	LOC_Os03g43460.1	downstream_gene_variant ; 4359.0bp to feature; MODIFIER	silent_mutation	Average:27.904; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0324235711	G -> A	LOC_Os03g43440-LOC_Os03g43460	intergenic_region ; MODIFIER	silent_mutation	Average:27.904; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0324235711	G -> DEL	N	N	silent_mutation	Average:27.904; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324235711	NA	1.26E-66	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324235711	NA	2.60E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324235711	NA	5.51E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324235711	NA	1.12E-86	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324235711	7.29E-08	5.00E-121	mr1750	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324235711	NA	4.18E-24	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324235711	NA	4.28E-110	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324235711	NA	3.35E-48	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324235711	NA	1.07E-151	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251