\
| Variant ID: vg0324228701 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24228701 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATGTACACATATAGTTTTACAAATTTCACAATTTTTTTTTAAATAAGACGAACGATCAAACATGTGCTAAAAAGGCAACGGTGTCAAACATTTTAAAAC[G/A]
GAGGGAGTAACAGTTACACAATGAGTGTATAGTATACCATCTTCCTTAGATACAACCTCTTAACTAAAATCTAACCTAGGGCCAGTTTGGTTTAGTGCCA
TGGCACTAAACCAAACTGGCCCTAGGTTAGATTTTAGTTAAGAGGTTGTATCTAAGGAAGATGGTATACTATACACTCATTGTGTAACTGTTACTCCCTC[C/T]
GTTTTAAAATGTTTGACACCGTTGCCTTTTTAGCACATGTTTGATCGTTCGTCTTATTTAAAAAAAAATTGTGAAATTTGTAAAACTATATGTGTACATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.70% | 21.30% | 2.01% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.60% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 36.40% | 58.30% | 5.29% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 58.50% | 34.30% | 7.17% | 0.00% | NA |
| Tropical Japonica | 504 | 9.90% | 87.70% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.20% | 73.40% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 87.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 25.60% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324228701 | G -> A | LOC_Os03g43440.1 | upstream_gene_variant ; 771.0bp to feature; MODIFIER | silent_mutation | Average:39.517; most accessible tissue: Callus, score: 59.228 | N | N | N | N |
| vg0324228701 | G -> A | LOC_Os03g43440-LOC_Os03g43460 | intergenic_region ; MODIFIER | silent_mutation | Average:39.517; most accessible tissue: Callus, score: 59.228 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324228701 | 1.70E-06 | NA | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324228701 | 7.74E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324228701 | NA | 2.94E-12 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324228701 | NA | 7.50E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324228701 | NA | 1.52E-14 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324228701 | NA | 4.15E-08 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324228701 | 1.85E-07 | NA | mr1585_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |