Variant ID: vg0324202574 (JBrowse) | Variation Type: SNP |
Chromosome: chr03 | Position: 24202574 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )
ACATATTATCTTCTCCACTTTAATTTGTATCTACATTAATATATGTATTAAAAGTCTACAAATAAATTGGTATAGTCTATTCTGAGTGTTTTGCAATTTT[A/C]
GGCACTAAGCACTTCAACTATCATCACGGGATCCCAATTTTATATTAATTACTAATTAAACTTAATGAGAATCATTAATGGCTAATTAGGGATAGGAAAT
ATTTCCTATCCCTAATTAGCCATTAATGATTCTCATTAAGTTTAATTAGTAATTAATATAAAATTGGGATCCCGTGATGATAGTTGAAGTGCTTAGTGCC[T/G]
AAAATTGCAAAACACTCAGAATAGACTATACCAATTTATTTGTAGACTTTTAATACATATATTAATGTAGATACAAATTAAAGTGGAGAAGATAATATGT
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.80% | 0.60% | 0.59% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 96.40% | 1.90% | 1.79% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 94.30% | 2.90% | 2.87% | 0.00% | NA |
Tropical Japonica | 504 | 99.20% | 0.20% | 0.60% | 0.00% | NA |
Japonica Intermediate | 241 | 97.10% | 2.10% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0324202574 | A -> C | LOC_Os03g43400.1 | upstream_gene_variant ; 553.0bp to feature; MODIFIER | silent_mutation | Average:51.191; most accessible tissue: Callus, score: 94.581 | N | N | N | N |
vg0324202574 | A -> C | LOC_Os03g43400-LOC_Os03g43410 | intergenic_region ; MODIFIER | silent_mutation | Average:51.191; most accessible tissue: Callus, score: 94.581 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0324202574 | 9.41E-07 | 9.41E-07 | mr1067 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324202574 | NA | 1.95E-07 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324202574 | NA | 7.93E-06 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324202574 | 4.92E-07 | 8.03E-09 | mr1100 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324202574 | NA | 4.30E-06 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324202574 | NA | 3.31E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324202574 | NA | 1.63E-07 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324202574 | 3.69E-06 | 3.69E-06 | mr1402 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324202574 | NA | 4.74E-08 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0324202574 | NA | 2.73E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/