RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0324202574:

Variant ID: vg0324202574 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24202574
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

ACATATTATCTTCTCCACTTTAATTTGTATCTACATTAATATATGTATTAAAAGTCTACAAATAAATTGGTATAGTCTATTCTGAGTGTTTTGCAATTTT[A/C]
GGCACTAAGCACTTCAACTATCATCACGGGATCCCAATTTTATATTAATTACTAATTAAACTTAATGAGAATCATTAATGGCTAATTAGGGATAGGAAAT

Reverse complement sequence

ATTTCCTATCCCTAATTAGCCATTAATGATTCTCATTAAGTTTAATTAGTAATTAATATAAAATTGGGATCCCGTGATGATAGTTGAAGTGCTTAGTGCC[T/G]
AAAATTGCAAAACACTCAGAATAGACTATACCAATTTATTTGTAGACTTTTAATACATATATTAATGTAGATACAAATTAAAGTGGAGAAGATAATATGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.80%	0.60%	0.59%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	96.40%	1.90%	1.79%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	94.30%	2.90%	2.87%	0.00%	NA
Tropical Japonica	504	99.20%	0.20%	0.60%	0.00%	NA
Japonica Intermediate	241	97.10%	2.10%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324202574	A -> C	LOC_Os03g43400.1	upstream_gene_variant ; 553.0bp to feature; MODIFIER	silent_mutation	Average:51.191; most accessible tissue: Callus, score: 94.581	N	N	N	N
vg0324202574	A -> C	LOC_Os03g43400-LOC_Os03g43410	intergenic_region ; MODIFIER	silent_mutation	Average:51.191; most accessible tissue: Callus, score: 94.581	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324202574	9.41E-07	9.41E-07	mr1067	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574	NA	1.95E-07	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574	NA	7.93E-06	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574	4.92E-07	8.03E-09	mr1100	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574	NA	4.30E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574	NA	3.31E-06	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574	NA	1.63E-07	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574	3.69E-06	3.69E-06	mr1402	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574	NA	4.74E-08	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574	NA	2.73E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 16 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0324202574:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact