Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324202574:

Variant ID: vg0324202574 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24202574
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ACATATTATCTTCTCCACTTTAATTTGTATCTACATTAATATATGTATTAAAAGTCTACAAATAAATTGGTATAGTCTATTCTGAGTGTTTTGCAATTTT[A/C]
GGCACTAAGCACTTCAACTATCATCACGGGATCCCAATTTTATATTAATTACTAATTAAACTTAATGAGAATCATTAATGGCTAATTAGGGATAGGAAAT

Reverse complement sequence

ATTTCCTATCCCTAATTAGCCATTAATGATTCTCATTAAGTTTAATTAGTAATTAATATAAAATTGGGATCCCGTGATGATAGTTGAAGTGCTTAGTGCC[T/G]
AAAATTGCAAAACACTCAGAATAGACTATACCAATTTATTTGTAGACTTTTAATACATATATTAATGTAGATACAAATTAAAGTGGAGAAGATAATATGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.80% 0.60% 0.59% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 96.40% 1.90% 1.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 94.30% 2.90% 2.87% 0.00% NA
Tropical Japonica  504 99.20% 0.20% 0.60% 0.00% NA
Japonica Intermediate  241 97.10% 2.10% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324202574 A -> C LOC_Os03g43400.1 upstream_gene_variant ; 553.0bp to feature; MODIFIER silent_mutation Average:51.191; most accessible tissue: Callus, score: 94.581 N N N N
vg0324202574 A -> C LOC_Os03g43400-LOC_Os03g43410 intergenic_region ; MODIFIER silent_mutation Average:51.191; most accessible tissue: Callus, score: 94.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324202574 9.41E-07 9.41E-07 mr1067 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 1.95E-07 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 7.93E-06 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 4.92E-07 8.03E-09 mr1100 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 4.30E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 3.31E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 1.63E-07 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 3.69E-06 3.69E-06 mr1402 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 4.74E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 2.73E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 4.73E-07 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 4.30E-06 4.30E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 7.43E-06 7.43E-06 mr1855 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 5.30E-06 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 NA 1.15E-06 mr1037_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324202574 3.19E-06 3.19E-06 mr1950_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251