Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324099807:

Variant ID: vg0324099807 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 24099807
Reference Allele: CCG	Alternative Allele: TCG,C
Primary Allele: CCG	Secondary Allele: TCG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGGCGCTCTTTGAATCGCTCTAAATTTTTGACAATCTTGACATCCTTTGTAATACTTGAAACAATCCTCTAGCATTGTCGGCCAAAAATATCCCGCTCG[CCG/TCG,C]
AAGCAACCACTTCATCTTATGAGCCAATTGATGAGTGCCACAAATCCCTTCATGTACCTCACTGATTGCAACCTTAGCCTGATCGGCACTCAAACATTTA

Reverse complement sequence

TAAATGTTTGAGTGCCGATCAGGCTAAGGTTGCAATCAGTGAGGTACATGAAGGGATTTGTGGCACTCATCAATTGGCTCATAAGATGAAGTGGTTGCTT[CGG/CGA,G]
CGAGCGGGATATTTTTGGCCGACAATGCTAGAGGATTGTTTCAAGTATTACAAAGGATGTCAAGATTGTCAAAAATTTAGAGCGATTCAAAGAGCGCCAG

Allele Frequencies:

Populations	Population Size	Frequency of CCG(primary allele)	Frequency of TCG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.30%	13.10%	25.33%	2.26%	C: 0.04%
All Indica	2759	34.10%	21.50%	40.52%	3.84%	C: 0.07%
All Japonica	1512	99.50%	0.00%	0.53%	0.00%	NA
Aus	269	80.30%	5.20%	14.13%	0.37%	NA
Indica I	595	31.80%	8.10%	51.09%	9.08%	NA
Indica II	465	38.90%	12.00%	43.87%	5.16%	NA
Indica III	913	33.00%	35.80%	31.11%	0.11%	NA
Indica Intermediate	786	34.40%	20.50%	41.48%	3.44%	C: 0.25%
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.79%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	82.30%	3.10%	14.58%	0.00%	NA
Intermediate	90	68.90%	10.00%	21.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324099807	CCG -> C	LOC_Os03g43220.1	frameshift_variant ; p.Arg1435fs; HIGH	frameshift_variant	Average:9.935; most accessible tissue: Zhenshan97 young leaf, score: 15.445	N	N	N	N
vg0324099807	CCG -> DEL	LOC_Os03g43220.1	N	frameshift_variant	Average:9.935; most accessible tissue: Zhenshan97 young leaf, score: 15.445	N	N	N	N
vg0324099807	CCG -> TCG	LOC_Os03g43220.1	synonymous_variant ; p.Arg1435Arg; LOW	synonymous_codon	Average:9.935; most accessible tissue: Zhenshan97 young leaf, score: 15.445	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324099807	8.01E-06	NA	mr1896	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324099807	NA	5.57E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324099807	NA	5.14E-10	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324099807	NA	1.40E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324099807	NA	1.00E-09	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324099807	NA	2.09E-07	mr1446_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324099807	NA	2.15E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251