\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324097319:

Variant ID: vg0324097319 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24097319
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCATCGAACAAGCTCTGGATGAAGAGGAGATTGAAGAGGATGTTGATCAAGCTGCAGCCGAAGTAAGCGATACTGAAAGAACACCATCGGCTTCACCCA[A/T]
GCAAACTCCTCCAACCCCTTCTGCTCCAGTCCATTTTTCAAGGGTAAACATCTCTCCTCAATTCCCTTATGTACTTATTTATTCATAACCGATTGCTCAT

Reverse complement sequence

ATGAGCAATCGGTTATGAATAAATAAGTACATAAGGGAATTGAGGAGAGATGTTTACCCTTGAAAAATGGACTGGAGCAGAAGGGGTTGGAGGAGTTTGC[T/A]
TGGGTGAAGCCGATGGTGTTCTTTCAGTATCGCTTACTTCGGCTGCAGCTTGATCAACATCCTCTTCAATCTCCTCTTCATCCAGAGCTTGTTCGATGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.50% 5.80% 5.31% 46.40% NA
All Indica  2759 6.50% 9.00% 7.32% 77.20% NA
All Japonica  1512 99.20% 0.10% 0.13% 0.53% NA
Aus  269 76.60% 4.50% 10.04% 8.92% NA
Indica I  595 7.60% 4.70% 7.90% 79.83% NA
Indica II  465 4.10% 10.80% 8.82% 76.34% NA
Indica III  913 3.40% 9.60% 6.68% 80.28% NA
Indica Intermediate  786 10.70% 10.40% 6.74% 72.14% NA
Temperate Japonica  767 99.50% 0.10% 0.00% 0.39% NA
Tropical Japonica  504 99.20% 0.20% 0.20% 0.40% NA
Japonica Intermediate  241 98.30% 0.00% 0.41% 1.24% NA
VI/Aromatic  96 76.00% 6.20% 13.54% 4.17% NA
Intermediate  90 57.80% 4.40% 7.78% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324097319 A -> T LOC_Os03g43200.1 downstream_gene_variant ; 3803.0bp to feature; MODIFIER silent_mutation Average:13.647; most accessible tissue: Callus, score: 43.845 N N N N
vg0324097319 A -> T LOC_Os03g43220.1 downstream_gene_variant ; 1453.0bp to feature; MODIFIER silent_mutation Average:13.647; most accessible tissue: Callus, score: 43.845 N N N N
vg0324097319 A -> T LOC_Os03g43210.1 intron_variant ; MODIFIER silent_mutation Average:13.647; most accessible tissue: Callus, score: 43.845 N N N N
vg0324097319 A -> DEL N N silent_mutation Average:13.647; most accessible tissue: Callus, score: 43.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324097319 NA 4.73E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 NA 4.98E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 NA 6.66E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 NA 2.11E-41 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 NA 5.46E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 NA 7.79E-08 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 NA 1.71E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 NA 3.56E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 NA 5.09E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 2.46E-06 2.46E-06 mr1987 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319 NA 3.02E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251