\
| Variant ID: vg0324097319 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24097319 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCATCGAACAAGCTCTGGATGAAGAGGAGATTGAAGAGGATGTTGATCAAGCTGCAGCCGAAGTAAGCGATACTGAAAGAACACCATCGGCTTCACCCA[A/T]
GCAAACTCCTCCAACCCCTTCTGCTCCAGTCCATTTTTCAAGGGTAAACATCTCTCCTCAATTCCCTTATGTACTTATTTATTCATAACCGATTGCTCAT
ATGAGCAATCGGTTATGAATAAATAAGTACATAAGGGAATTGAGGAGAGATGTTTACCCTTGAAAAATGGACTGGAGCAGAAGGGGTTGGAGGAGTTTGC[T/A]
TGGGTGAAGCCGATGGTGTTCTTTCAGTATCGCTTACTTCGGCTGCAGCTTGATCAACATCCTCTTCAATCTCCTCTTCATCCAGAGCTTGTTCGATGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.50% | 5.80% | 5.31% | 46.40% | NA |
| All Indica | 2759 | 6.50% | 9.00% | 7.32% | 77.20% | NA |
| All Japonica | 1512 | 99.20% | 0.10% | 0.13% | 0.53% | NA |
| Aus | 269 | 76.60% | 4.50% | 10.04% | 8.92% | NA |
| Indica I | 595 | 7.60% | 4.70% | 7.90% | 79.83% | NA |
| Indica II | 465 | 4.10% | 10.80% | 8.82% | 76.34% | NA |
| Indica III | 913 | 3.40% | 9.60% | 6.68% | 80.28% | NA |
| Indica Intermediate | 786 | 10.70% | 10.40% | 6.74% | 72.14% | NA |
| Temperate Japonica | 767 | 99.50% | 0.10% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 99.20% | 0.20% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 76.00% | 6.20% | 13.54% | 4.17% | NA |
| Intermediate | 90 | 57.80% | 4.40% | 7.78% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324097319 | A -> T | LOC_Os03g43200.1 | downstream_gene_variant ; 3803.0bp to feature; MODIFIER | silent_mutation | Average:13.647; most accessible tissue: Callus, score: 43.845 | N | N | N | N |
| vg0324097319 | A -> T | LOC_Os03g43220.1 | downstream_gene_variant ; 1453.0bp to feature; MODIFIER | silent_mutation | Average:13.647; most accessible tissue: Callus, score: 43.845 | N | N | N | N |
| vg0324097319 | A -> T | LOC_Os03g43210.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.647; most accessible tissue: Callus, score: 43.845 | N | N | N | N |
| vg0324097319 | A -> DEL | N | N | silent_mutation | Average:13.647; most accessible tissue: Callus, score: 43.845 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324097319 | NA | 4.73E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | NA | 4.98E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | NA | 6.66E-08 | mr1249 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | NA | 2.11E-41 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | NA | 5.46E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | NA | 7.79E-08 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | NA | 1.71E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | NA | 3.56E-18 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | NA | 5.09E-15 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | 2.46E-06 | 2.46E-06 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324097319 | NA | 3.02E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |