Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324097319:

Variant ID: vg0324097319 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24097319
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCATCGAACAAGCTCTGGATGAAGAGGAGATTGAAGAGGATGTTGATCAAGCTGCAGCCGAAGTAAGCGATACTGAAAGAACACCATCGGCTTCACCCA[A/T]
GCAAACTCCTCCAACCCCTTCTGCTCCAGTCCATTTTTCAAGGGTAAACATCTCTCCTCAATTCCCTTATGTACTTATTTATTCATAACCGATTGCTCAT

Reverse complement sequence

ATGAGCAATCGGTTATGAATAAATAAGTACATAAGGGAATTGAGGAGAGATGTTTACCCTTGAAAAATGGACTGGAGCAGAAGGGGTTGGAGGAGTTTGC[T/A]
TGGGTGAAGCCGATGGTGTTCTTTCAGTATCGCTTACTTCGGCTGCAGCTTGATCAACATCCTCTTCAATCTCCTCTTCATCCAGAGCTTGTTCGATGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.50%	5.80%	5.31%	46.40%	NA
All Indica	2759	6.50%	9.00%	7.32%	77.20%	NA
All Japonica	1512	99.20%	0.10%	0.13%	0.53%	NA
Aus	269	76.60%	4.50%	10.04%	8.92%	NA
Indica I	595	7.60%	4.70%	7.90%	79.83%	NA
Indica II	465	4.10%	10.80%	8.82%	76.34%	NA
Indica III	913	3.40%	9.60%	6.68%	80.28%	NA
Indica Intermediate	786	10.70%	10.40%	6.74%	72.14%	NA
Temperate Japonica	767	99.50%	0.10%	0.00%	0.39%	NA
Tropical Japonica	504	99.20%	0.20%	0.20%	0.40%	NA
Japonica Intermediate	241	98.30%	0.00%	0.41%	1.24%	NA
VI/Aromatic	96	76.00%	6.20%	13.54%	4.17%	NA
Intermediate	90	57.80%	4.40%	7.78%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324097319	A -> T	LOC_Os03g43200.1	downstream_gene_variant ; 3803.0bp to feature; MODIFIER	silent_mutation	Average:13.647; most accessible tissue: Callus, score: 43.845	N	N	N	N
vg0324097319	A -> T	LOC_Os03g43220.1	downstream_gene_variant ; 1453.0bp to feature; MODIFIER	silent_mutation	Average:13.647; most accessible tissue: Callus, score: 43.845	N	N	N	N
vg0324097319	A -> T	LOC_Os03g43210.1	intron_variant ; MODIFIER	silent_mutation	Average:13.647; most accessible tissue: Callus, score: 43.845	N	N	N	N
vg0324097319	A -> DEL	N	N	silent_mutation	Average:13.647; most accessible tissue: Callus, score: 43.845	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324097319	NA	4.73E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	NA	4.98E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	NA	6.66E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	NA	2.11E-41	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	NA	5.46E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	NA	7.79E-08	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	NA	1.71E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	NA	3.56E-18	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	NA	5.09E-15	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	2.46E-06	2.46E-06	mr1987	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324097319	NA	3.02E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251