\
| Variant ID: vg0324095631 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24095631 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 36. )
GGAAGAACACTTTCAAATCTTGGCCATCTCTTGAGAAAACTTCACCCGAGAAAAGCTGGGTTACATGGTACAAGCGCGTATCGGCTAGTAAGCAAACACA[T/C]
TGGGACGAGATTGGAATCGGCCAAGCACTTGCCCTCACCATAGCAAATTCGGCTAAGGACGAACCCTTAATAGCCGCTGCCACCTATTTCTGGTCCAATA
TATTGGACCAGAAATAGGTGGCAGCGGCTATTAAGGGTTCGTCCTTAGCCGAATTTGCTATGGTGAGGGCAAGTGCTTGGCCGATTCCAATCTCGTCCCA[A/G]
TGTGTTTGCTTACTAGCCGATACGCGCTTGTACCATGTAACCCAGCTTTTCTCGGGTGAAGTTTTCTCAAGAGATGGCCAAGATTTGAAAGTGTTCTTCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.50% | 3.40% | 2.26% | 52.79% | NA |
| All Indica | 2759 | 5.10% | 5.50% | 2.28% | 87.17% | NA |
| All Japonica | 1512 | 99.10% | 0.10% | 0.07% | 0.73% | NA |
| Aus | 269 | 75.50% | 1.90% | 9.67% | 13.01% | NA |
| Indica I | 595 | 6.70% | 3.40% | 2.86% | 87.06% | NA |
| Indica II | 465 | 3.20% | 7.50% | 1.72% | 87.53% | NA |
| Indica III | 913 | 1.60% | 5.60% | 2.52% | 90.25% | NA |
| Indica Intermediate | 786 | 8.90% | 5.70% | 1.91% | 83.46% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 98.80% | 0.40% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 76.00% | 1.00% | 16.67% | 6.25% | NA |
| Intermediate | 90 | 53.30% | 3.30% | 1.11% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324095631 | T -> C | LOC_Os03g43210.1 | synonymous_variant ; p.His100His; LOW | synonymous_codon | Average:23.847; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| vg0324095631 | T -> DEL | LOC_Os03g43210.1 | N | frameshift_variant | Average:23.847; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324095631 | NA | 4.15E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 1.04E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 5.94E-23 | mr1571 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 8.19E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | 3.29E-07 | 3.29E-07 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 2.40E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 3.30E-16 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 2.72E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 3.96E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 1.25E-21 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 4.99E-13 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 7.10E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 3.81E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 7.37E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 8.52E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 3.41E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 6.92E-20 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324095631 | NA | 6.86E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |