\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324094127:

Variant ID: vg0324094127 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24094127
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTAACATAAAGGGCGGATTTAACATGTGAATAAAGCATATAAGATAAATGTAGTTAAATCAGGTAAGATCGGCTGAAACCCCGATGCTACCCTAATCGG[C/T,A]
AACCAAAAGCAGGCTAGAGATTGTGATTCTAATCACGACTCATAAGATCAAACTCAACTGATGCAGCTATAAGTATGAAAAGAAAAACAATATCTAGACA

Reverse complement sequence

TGTCTAGATATTGTTTTTCTTTTCATACTTATAGCTGCATCAGTTGAGTTTGATCTTATGAGTCGTGATTAGAATCACAATCTCTAGCCTGCTTTTGGTT[G/A,T]
CCGATTAGGGTAGCATCGGGGTTTCAGCCGATCTTACCTGATTTAACTACATTTATCTTATATGCTTTATTCACATGTTAAATCCGCCCTTTATGTTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.80% 0.50% 1.10% 0.57% A: 0.04%
All Indica  2759 96.40% 0.80% 1.85% 0.87% A: 0.07%
All Japonica  1512 99.90% 0.00% 0.00% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 0.50% 0.84% 0.34% NA
Indica II  465 95.90% 1.70% 1.94% 0.00% A: 0.43%
Indica III  913 94.50% 0.70% 3.40% 1.42% NA
Indica Intermediate  786 97.50% 0.60% 0.76% 1.15% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324094127 C -> T LOC_Os03g43210.1 upstream_gene_variant ; 1116.0bp to feature; MODIFIER silent_mutation Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0324094127 C -> T LOC_Os03g43200.1 downstream_gene_variant ; 611.0bp to feature; MODIFIER silent_mutation Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0324094127 C -> T LOC_Os03g43220.1 downstream_gene_variant ; 4645.0bp to feature; MODIFIER silent_mutation Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0324094127 C -> T LOC_Os03g43200-LOC_Os03g43210 intergenic_region ; MODIFIER silent_mutation Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0324094127 C -> A LOC_Os03g43210.1 upstream_gene_variant ; 1116.0bp to feature; MODIFIER silent_mutation Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0324094127 C -> A LOC_Os03g43200.1 downstream_gene_variant ; 611.0bp to feature; MODIFIER silent_mutation Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0324094127 C -> A LOC_Os03g43220.1 downstream_gene_variant ; 4645.0bp to feature; MODIFIER silent_mutation Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0324094127 C -> A LOC_Os03g43200-LOC_Os03g43210 intergenic_region ; MODIFIER silent_mutation Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0324094127 C -> DEL N N silent_mutation Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324094127 NA 4.25E-06 mr1428 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324094127 NA 3.72E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324094127 3.55E-07 3.55E-07 mr1462 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324094127 2.11E-06 2.11E-06 mr1462 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324094127 NA 9.46E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251