\
| Variant ID: vg0324094127 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24094127 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTAACATAAAGGGCGGATTTAACATGTGAATAAAGCATATAAGATAAATGTAGTTAAATCAGGTAAGATCGGCTGAAACCCCGATGCTACCCTAATCGG[C/T,A]
AACCAAAAGCAGGCTAGAGATTGTGATTCTAATCACGACTCATAAGATCAAACTCAACTGATGCAGCTATAAGTATGAAAAGAAAAACAATATCTAGACA
TGTCTAGATATTGTTTTTCTTTTCATACTTATAGCTGCATCAGTTGAGTTTGATCTTATGAGTCGTGATTAGAATCACAATCTCTAGCCTGCTTTTGGTT[G/A,T]
CCGATTAGGGTAGCATCGGGGTTTCAGCCGATCTTACCTGATTTAACTACATTTATCTTATATGCTTTATTCACATGTTAAATCCGCCCTTTATGTTAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.80% | 0.50% | 1.10% | 0.57% | A: 0.04% |
| All Indica | 2759 | 96.40% | 0.80% | 1.85% | 0.87% | A: 0.07% |
| All Japonica | 1512 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.50% | 0.84% | 0.34% | NA |
| Indica II | 465 | 95.90% | 1.70% | 1.94% | 0.00% | A: 0.43% |
| Indica III | 913 | 94.50% | 0.70% | 3.40% | 1.42% | NA |
| Indica Intermediate | 786 | 97.50% | 0.60% | 0.76% | 1.15% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324094127 | C -> T | LOC_Os03g43210.1 | upstream_gene_variant ; 1116.0bp to feature; MODIFIER | silent_mutation | Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0324094127 | C -> T | LOC_Os03g43200.1 | downstream_gene_variant ; 611.0bp to feature; MODIFIER | silent_mutation | Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0324094127 | C -> T | LOC_Os03g43220.1 | downstream_gene_variant ; 4645.0bp to feature; MODIFIER | silent_mutation | Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0324094127 | C -> T | LOC_Os03g43200-LOC_Os03g43210 | intergenic_region ; MODIFIER | silent_mutation | Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0324094127 | C -> A | LOC_Os03g43210.1 | upstream_gene_variant ; 1116.0bp to feature; MODIFIER | silent_mutation | Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0324094127 | C -> A | LOC_Os03g43200.1 | downstream_gene_variant ; 611.0bp to feature; MODIFIER | silent_mutation | Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0324094127 | C -> A | LOC_Os03g43220.1 | downstream_gene_variant ; 4645.0bp to feature; MODIFIER | silent_mutation | Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0324094127 | C -> A | LOC_Os03g43200-LOC_Os03g43210 | intergenic_region ; MODIFIER | silent_mutation | Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0324094127 | C -> DEL | N | N | silent_mutation | Average:8.629; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324094127 | NA | 4.25E-06 | mr1428 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324094127 | NA | 3.72E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324094127 | 3.55E-07 | 3.55E-07 | mr1462 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324094127 | 2.11E-06 | 2.11E-06 | mr1462 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324094127 | NA | 9.46E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |