\
| Variant ID: vg0324085319 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24085319 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACCGTTGACGTCGAGCCGAGCCGTGCCGTCGTCGGAGCTCGTCGCCGGCCGCCGTACGTCGTCGTCCGTCGTAGTTTCTTGCACCGGTGAGTTCGTGTC[G/A]
TCGTCCTCTTCGCGTAGGTGTCCTCGGATAGCCCGGCCGAGCCCTCTATCGCCGGTGGTTGCGTCGTCCCGTGCCATGGCCGGCGATGATGTCATCGTGA
TCACGATGACATCATCGCCGGCCATGGCACGGGACGACGCAACCACCGGCGATAGAGGGCTCGGCCGGGCTATCCGAGGACACCTACGCGAAGAGGACGA[C/T]
GACACGAACTCACCGGTGCAAGAAACTACGACGGACGACGACGTACGGCGGCCGGCGACGAGCTCCGACGACGGCACGGCTCGGCTCGACGTCAACGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.10% | 13.00% | 3.51% | 56.41% | NA |
| All Indica | 2759 | 3.40% | 0.50% | 2.72% | 93.37% | NA |
| All Japonica | 1512 | 56.70% | 38.60% | 3.84% | 0.86% | NA |
| Aus | 269 | 84.80% | 0.00% | 2.97% | 12.27% | NA |
| Indica I | 595 | 1.80% | 0.30% | 5.21% | 92.61% | NA |
| Indica II | 465 | 3.70% | 0.00% | 1.29% | 95.05% | NA |
| Indica III | 913 | 1.50% | 0.70% | 0.88% | 96.93% | NA |
| Indica Intermediate | 786 | 6.50% | 0.90% | 3.82% | 88.80% | NA |
| Temperate Japonica | 767 | 89.20% | 6.40% | 3.91% | 0.52% | NA |
| Tropical Japonica | 504 | 14.30% | 81.70% | 2.98% | 0.99% | NA |
| Japonica Intermediate | 241 | 42.30% | 50.60% | 5.39% | 1.66% | NA |
| VI/Aromatic | 96 | 79.20% | 1.00% | 13.54% | 6.25% | NA |
| Intermediate | 90 | 26.70% | 17.80% | 13.33% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324085319 | G -> A | LOC_Os03g43180.1 | synonymous_variant ; p.Asp26Asp; LOW | synonymous_codon | Average:13.708; most accessible tissue: Callus, score: 19.897 | N | N | N | N |
| vg0324085319 | G -> DEL | LOC_Os03g43180.1 | N | frameshift_variant | Average:13.708; most accessible tissue: Callus, score: 19.897 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324085319 | NA | 2.06E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 2.69E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 1.63E-28 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | 9.81E-08 | NA | mr1745 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 1.04E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 1.58E-22 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 1.10E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 4.56E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 2.27E-09 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 7.01E-09 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 1.43E-28 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 1.06E-14 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 4.99E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324085319 | NA | 1.07E-23 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |