Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324083783:

Variant ID: vg0324083783 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24083783
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:

AAGCTAGTCTTCAAATGGCTCCATATGAAGCATTGTATGGTTGGAAGTGTCGTACACCGCTCCTTTGGGATCAGACCGGTGAGCGTCAAGTTTTTGGGAC[C/A]
GATGTATTGCGAGAGGCAGAAGAAAAAGTGAAGATTATCCAAGAAAGGTTGCGTATTGCCTAGTCACGTCAGAAGAGCTATGCAAACAATCGTCGTAGGG

Reverse complement sequence

CCCTACGACGATTGTTTGCATAGCTCTTCTGACGTGACTAGGCAATACGCAACCTTTCTTGGATAATCTTCACTTTTTCTTCTGCCTCTCGCAATACATC[G/T]
GTCCCAAAAACTTGACGCTCACCGGTCTGATCCCAAAGGAGCGGTGTACGACACTTCCAACCATACAATGCTTCATATGGAGCCATTTGAAGACTAGCTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.90%	0.10%	3.41%	53.51%	NA
All Indica	2759	6.90%	0.20%	4.35%	88.55%	NA
All Japonica	1512	99.20%	0.00%	0.07%	0.73%	NA
Aus	269	78.80%	0.40%	9.29%	11.52%	NA
Indica I	595	9.20%	0.00%	7.73%	83.03%	NA
Indica II	465	4.90%	0.40%	2.80%	91.83%	NA
Indica III	913	3.20%	0.10%	2.30%	94.41%	NA
Indica Intermediate	786	10.60%	0.40%	5.09%	83.97%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	99.00%	0.00%	0.00%	0.99%	NA
Japonica Intermediate	241	98.30%	0.00%	0.41%	1.24%	NA
VI/Aromatic	96	80.20%	0.00%	10.42%	9.38%	NA
Intermediate	90	55.60%	0.00%	5.56%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324083783	C -> A	LOC_Os03g43169.1	upstream_gene_variant ; 265.0bp to feature; MODIFIER	silent_mutation	Average:19.724; most accessible tissue: Callus, score: 36.803	N	N	N	N
vg0324083783	C -> A	LOC_Os03g43160.1	downstream_gene_variant ; 958.0bp to feature; MODIFIER	silent_mutation	Average:19.724; most accessible tissue: Callus, score: 36.803	N	N	N	N
vg0324083783	C -> A	LOC_Os03g43180.1	downstream_gene_variant ; 1290.0bp to feature; MODIFIER	silent_mutation	Average:19.724; most accessible tissue: Callus, score: 36.803	N	N	N	N
vg0324083783	C -> A	LOC_Os03g43190.1	downstream_gene_variant ; 3296.0bp to feature; MODIFIER	silent_mutation	Average:19.724; most accessible tissue: Callus, score: 36.803	N	N	N	N
vg0324083783	C -> A	LOC_Os03g43160-LOC_Os03g43169	intergenic_region ; MODIFIER	silent_mutation	Average:19.724; most accessible tissue: Callus, score: 36.803	N	N	N	N
vg0324083783	C -> DEL	N	N	silent_mutation	Average:19.724; most accessible tissue: Callus, score: 36.803	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324083783	NA	8.18E-06	mr1046_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.04E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.50E-15	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.28E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	2.18E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.40E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	8.47E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	7.44E-06	mr1351_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	2.83E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.60E-12	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.16E-31	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.54E-10	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.92E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	6.71E-06	3.97E-06	mr1844_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	5.90E-06	mr1873_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.20E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	2.42E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	NA	1.29E-14	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783	5.05E-07	6.71E-09	mr1987_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251