\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324083783:

Variant ID: vg0324083783 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24083783
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCTAGTCTTCAAATGGCTCCATATGAAGCATTGTATGGTTGGAAGTGTCGTACACCGCTCCTTTGGGATCAGACCGGTGAGCGTCAAGTTTTTGGGAC[C/A]
GATGTATTGCGAGAGGCAGAAGAAAAAGTGAAGATTATCCAAGAAAGGTTGCGTATTGCCTAGTCACGTCAGAAGAGCTATGCAAACAATCGTCGTAGGG

Reverse complement sequence

CCCTACGACGATTGTTTGCATAGCTCTTCTGACGTGACTAGGCAATACGCAACCTTTCTTGGATAATCTTCACTTTTTCTTCTGCCTCTCGCAATACATC[G/T]
GTCCCAAAAACTTGACGCTCACCGGTCTGATCCCAAAGGAGCGGTGTACGACACTTCCAACCATACAATGCTTCATATGGAGCCATTTGAAGACTAGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.90% 0.10% 3.41% 53.51% NA
All Indica  2759 6.90% 0.20% 4.35% 88.55% NA
All Japonica  1512 99.20% 0.00% 0.07% 0.73% NA
Aus  269 78.80% 0.40% 9.29% 11.52% NA
Indica I  595 9.20% 0.00% 7.73% 83.03% NA
Indica II  465 4.90% 0.40% 2.80% 91.83% NA
Indica III  913 3.20% 0.10% 2.30% 94.41% NA
Indica Intermediate  786 10.60% 0.40% 5.09% 83.97% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 99.00% 0.00% 0.00% 0.99% NA
Japonica Intermediate  241 98.30% 0.00% 0.41% 1.24% NA
VI/Aromatic  96 80.20% 0.00% 10.42% 9.38% NA
Intermediate  90 55.60% 0.00% 5.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324083783 C -> A LOC_Os03g43169.1 upstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:19.724; most accessible tissue: Callus, score: 36.803 N N N N
vg0324083783 C -> A LOC_Os03g43160.1 downstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:19.724; most accessible tissue: Callus, score: 36.803 N N N N
vg0324083783 C -> A LOC_Os03g43180.1 downstream_gene_variant ; 1290.0bp to feature; MODIFIER silent_mutation Average:19.724; most accessible tissue: Callus, score: 36.803 N N N N
vg0324083783 C -> A LOC_Os03g43190.1 downstream_gene_variant ; 3296.0bp to feature; MODIFIER silent_mutation Average:19.724; most accessible tissue: Callus, score: 36.803 N N N N
vg0324083783 C -> A LOC_Os03g43160-LOC_Os03g43169 intergenic_region ; MODIFIER silent_mutation Average:19.724; most accessible tissue: Callus, score: 36.803 N N N N
vg0324083783 C -> DEL N N silent_mutation Average:19.724; most accessible tissue: Callus, score: 36.803 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324083783 NA 8.18E-06 mr1046_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.04E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.50E-15 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.28E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 2.18E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.40E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 8.47E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 7.44E-06 mr1351_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 2.83E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.60E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.16E-31 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.54E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.92E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 6.71E-06 3.97E-06 mr1844_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 5.90E-06 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.20E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 2.42E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 NA 1.29E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083783 5.05E-07 6.71E-09 mr1987_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251